Incidental Mutation 'R4982:Gpr75'
ID384931
Institutional Source Beutler Lab
Gene Symbol Gpr75
Ensembl Gene ENSMUSG00000043999
Gene NameG protein-coupled receptor 75
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4982 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location30885358-30893729 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30891462 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 122 (H122Q)
Ref Sequence ENSEMBL: ENSMUSP00000105057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109430] [ENSMUST00000203878]
Predicted Effect probably damaging
Transcript: ENSMUST00000109430
AA Change: H122Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105057
Gene: ENSMUSG00000043999
AA Change: H122Q

DomainStartEndE-ValueType
Pfam:7tm_1 59 376 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203878
SMART Domains Protein: ENSMUSP00000144900
Gene: ENSMUSG00000020305

DomainStartEndE-ValueType
low complexity region 20 36 N/A INTRINSIC
ANK 48 77 3.5e-2 SMART
ANK 81 110 8e-3 SMART
ANK 117 146 4.8e-5 SMART
ANK 150 179 1.7e-7 SMART
ANK 184 213 1.8e-4 SMART
ANK 217 246 1.8e-6 SMART
ANK 250 279 1.2e-7 SMART
ANK 285 315 1.1e0 SMART
ANK 318 347 1.2e-3 SMART
ANK 354 385 7.7e-1 SMART
SOCS 493 542 2.8e-4 SMART
SOCS_box 499 541 1.6e-17 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] GPR75 is a member of the G protein-coupled receptor family. GPRs are cell surface receptors that activate guanine-nucleotide binding proteins upon the binding of a ligand.[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Gpr75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Gpr75 APN 11 30891590 missense probably damaging 1.00
IGL00787:Gpr75 APN 11 30892290 missense probably benign 0.00
IGL01102:Gpr75 APN 11 30891755 missense probably benign 0.41
IGL01790:Gpr75 APN 11 30891132 missense probably damaging 0.97
IGL01975:Gpr75 APN 11 30891835 missense probably benign 0.09
IGL02266:Gpr75 APN 11 30891977 missense probably benign 0.01
IGL02338:Gpr75 APN 11 30891730 missense probably benign 0.00
IGL02394:Gpr75 APN 11 30892190 missense possibly damaging 0.92
IGL03208:Gpr75 APN 11 30892699 missense probably damaging 1.00
R0053:Gpr75 UTSW 11 30892571 missense possibly damaging 0.71
R0053:Gpr75 UTSW 11 30892571 missense possibly damaging 0.71
R0449:Gpr75 UTSW 11 30892456 missense probably damaging 0.99
R1289:Gpr75 UTSW 11 30892706 missense probably benign 0.23
R1760:Gpr75 UTSW 11 30891527 missense probably damaging 1.00
R3123:Gpr75 UTSW 11 30891709 missense possibly damaging 0.82
R4669:Gpr75 UTSW 11 30892072 missense probably damaging 1.00
R4704:Gpr75 UTSW 11 30891110 missense probably benign
R4809:Gpr75 UTSW 11 30892154 missense possibly damaging 0.74
R4913:Gpr75 UTSW 11 30891808 missense possibly damaging 0.85
R4982:Gpr75 UTSW 11 30891463 missense possibly damaging 0.96
R5071:Gpr75 UTSW 11 30892380 missense probably damaging 1.00
R5318:Gpr75 UTSW 11 30892459 missense probably benign 0.00
R6019:Gpr75 UTSW 11 30891640 missense probably benign 0.39
R6199:Gpr75 UTSW 11 30891527 missense probably damaging 1.00
R6455:Gpr75 UTSW 11 30891529 missense probably damaging 1.00
R7188:Gpr75 UTSW 11 30892687 missense probably damaging 1.00
R7826:Gpr75 UTSW 11 30891209 missense probably damaging 0.99
R8053:Gpr75 UTSW 11 30891559 missense probably benign 0.25
Z1088:Gpr75 UTSW 11 30891139 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GGTGACCTGCACTTTTCTGC -3'
(R):5'- TTCTCAGTGTAGCCAAGGTG -3'

Sequencing Primer
(F):5'- ATCATCTTCTGTCTAGGCTCTTATGG -3'
(R):5'- TGGCAAGTGTAAAGCTGGTC -3'
Posted On2016-05-10