Incidental Mutation 'R4982:Adra1b'
ID 384933
Institutional Source Beutler Lab
Gene Symbol Adra1b
Ensembl Gene ENSMUSG00000050541
Gene Name adrenergic receptor, alpha 1b
Synonyms alpha1B-adrenergic receptor
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 43665433-43792037 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43726057 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 287 (S287P)
Ref Sequence ENSEMBL: ENSMUSP00000129200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067258] [ENSMUST00000139906] [ENSMUST00000167574]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000067258
AA Change: S287P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070200
Gene: ENSMUSG00000050541
AA Change: S287P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 54 182 1.3e-6 PFAM
Pfam:7TM_GPCR_Srsx 56 363 3.7e-17 PFAM
Pfam:7tm_1 62 348 7.9e-84 PFAM
low complexity region 368 381 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124306
Predicted Effect probably damaging
Transcript: ENSMUST00000139906
AA Change: S287P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123435
Gene: ENSMUSG00000050541
AA Change: S287P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 54 183 4.4e-7 PFAM
Pfam:7TM_GPCR_Srsx 56 363 1.8e-17 PFAM
Pfam:7tm_1 62 348 2.7e-84 PFAM
low complexity region 368 381 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167574
AA Change: S287P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129200
Gene: ENSMUSG00000050541
AA Change: S287P

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 54 182 8.5e-7 PFAM
Pfam:7TM_GPCR_Srsx 56 363 3.7e-17 PFAM
Pfam:7tm_1 62 348 1.2e-79 PFAM
low complexity region 368 381 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Alpha-1-adrenergic receptors (alpha-1-ARs) are members of the G protein-coupled receptor superfamily. They activate mitogenic responses and regulate growth and proliferation of many cells. There are 3 alpha-1-AR subtypes: alpha-1A, -1B and -1D, all of which signal through the Gq/11 family of G-proteins and different subtypes show different patterns of activation. This gene encodes alpha-1B-adrenergic receptor, which induces neoplastic transformation when transfected into NIH 3T3 fibroblasts and other cell lines. Thus, this normal cellular gene is identified as a protooncogene. This gene comprises 2 exons and a single large intron of at least 20 kb that interrupts the coding region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted mutations that inactivate the gene affect atrial contractility and left ventricle function, suggesting their use in modeling chronic heart failure in humans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,348 (GRCm39) I1404L possibly damaging Het
Atxn2 G T 5: 121,952,406 (GRCm39) A1280S possibly damaging Het
Bbip1 T C 19: 53,920,639 (GRCm39) probably null Het
Bbs2 A G 8: 94,808,982 (GRCm39) probably null Het
Bcl11b A T 12: 107,932,031 (GRCm39) C180* probably null Het
Bltp3a T C 17: 28,105,580 (GRCm39) F702S probably benign Het
Bod1l A G 5: 41,977,816 (GRCm39) V1166A probably benign Het
Bora C T 14: 99,284,788 (GRCm39) P13S probably damaging Het
C2cd4c T C 10: 79,449,075 (GRCm39) E24G probably benign Het
Ccne1 A T 7: 37,799,996 (GRCm39) I196N probably damaging Het
Chsy3 C T 18: 59,542,647 (GRCm39) S595L probably benign Het
Chsy3 T A 18: 59,542,839 (GRCm39) I659N possibly damaging Het
Cntrob T A 11: 69,202,188 (GRCm39) probably null Het
Col5a2 G A 1: 45,428,618 (GRCm39) P983S possibly damaging Het
Crat T A 2: 30,297,148 (GRCm39) probably null Het
Ctnnbl1 C T 2: 157,678,473 (GRCm39) H359Y probably benign Het
D430041D05Rik A G 2: 104,085,732 (GRCm39) V83A possibly damaging Het
Dixdc1 A G 9: 50,593,902 (GRCm39) S488P possibly damaging Het
Dmrta1 T C 4: 89,576,801 (GRCm39) C86R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Fam171a1 G A 2: 3,179,505 (GRCm39) probably null Het
Fam222b T C 11: 78,045,569 (GRCm39) C249R probably damaging Het
Fbxw18 T A 9: 109,531,719 (GRCm39) probably benign Het
Fes T C 7: 80,036,952 (GRCm39) Y44C probably damaging Het
Gimap6 A G 6: 48,684,933 (GRCm39) V51A probably benign Het
Gpr75 C T 11: 30,841,463 (GRCm39) L123F possibly damaging Het
Gpr75 C A 11: 30,841,462 (GRCm39) H122Q probably damaging Het
Greb1 A G 12: 16,774,762 (GRCm39) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm39) H1041R probably benign Het
Ifna5 A G 4: 88,753,861 (GRCm39) N34D probably damaging Het
Ift140 A T 17: 25,255,968 (GRCm39) H221L probably damaging Het
Igsf3 T C 3: 101,342,983 (GRCm39) V540A probably benign Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Klra2 A T 6: 131,197,152 (GRCm39) D282E probably benign Het
Lyst T A 13: 13,900,539 (GRCm39) H3138Q probably damaging Het
Malrd1 A G 2: 16,046,940 (GRCm39) T1689A probably benign Het
Mon2 A T 10: 122,831,694 (GRCm39) L1671M probably damaging Het
Mpped1 T C 15: 83,720,528 (GRCm39) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm39) H541Q probably benign Het
Muc5ac T A 7: 141,363,193 (GRCm39) probably benign Het
Mybbp1a T C 11: 72,336,040 (GRCm39) I451T probably damaging Het
Myh7 T A 14: 55,210,224 (GRCm39) E1827V probably damaging Het
Or1j14 A T 2: 36,417,409 (GRCm39) probably null Het
Or2h15 A T 17: 38,441,468 (GRCm39) I205N probably damaging Het
Or5p75-ps1 T A 7: 108,107,855 (GRCm39) Y197* probably null Het
Or8b8 C A 9: 37,808,811 (GRCm39) T37N probably damaging Het
Os9 C T 10: 126,956,920 (GRCm39) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm39) L261P probably damaging Het
Pcdhga2 A G 18: 37,802,476 (GRCm39) N107D probably benign Het
Pclo C T 5: 14,729,308 (GRCm39) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phtf1 T A 3: 103,906,024 (GRCm39) S524T probably damaging Het
Pkdrej A C 15: 85,703,197 (GRCm39) L913R probably damaging Het
Pld1 C A 3: 28,085,447 (GRCm39) A201D probably damaging Het
Rorb T A 19: 18,955,052 (GRCm39) Q103L probably benign Het
Sec24d C T 3: 123,093,255 (GRCm39) T284M probably benign Het
Serpinb3b T C 1: 107,085,484 (GRCm39) I86V probably benign Het
Serpinb6a A T 13: 34,102,857 (GRCm39) M201K probably damaging Het
Snx8 A G 5: 140,337,989 (GRCm39) S219P probably benign Het
Sp8 C T 12: 118,812,160 (GRCm39) T5I probably damaging Het
Tanc1 A G 2: 59,630,287 (GRCm39) N749D probably damaging Het
Tarm1 G C 7: 3,537,612 (GRCm39) P284A probably damaging Het
Tbx15 A T 3: 99,161,390 (GRCm39) E65V probably benign Het
Ticam1 T A 17: 56,579,020 (GRCm39) H25L probably benign Het
Tmprss11g T A 5: 86,640,674 (GRCm39) L170F probably damaging Het
Tnfsf9 A G 17: 57,414,504 (GRCm39) *310W probably null Het
Tsks C T 7: 44,593,418 (GRCm39) T128I possibly damaging Het
Vmn1r175 A T 7: 23,508,494 (GRCm39) N44K possibly damaging Het
Vmn1r45 A G 6: 89,910,847 (GRCm39) I41T probably damaging Het
Ythdc2 A G 18: 45,004,532 (GRCm39) N1102S probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Adra1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01775:Adra1b APN 11 43,726,128 (GRCm39) missense probably damaging 0.98
R1827:Adra1b UTSW 11 43,726,476 (GRCm39) missense probably damaging 1.00
R2073:Adra1b UTSW 11 43,726,698 (GRCm39) missense probably damaging 1.00
R6418:Adra1b UTSW 11 43,667,028 (GRCm39) missense probably benign 0.17
R6763:Adra1b UTSW 11 43,666,833 (GRCm39) missense possibly damaging 0.88
R6787:Adra1b UTSW 11 43,726,242 (GRCm39) missense probably damaging 1.00
R7236:Adra1b UTSW 11 43,667,151 (GRCm39) missense possibly damaging 0.67
R7402:Adra1b UTSW 11 43,666,845 (GRCm39) missense possibly damaging 0.95
R7491:Adra1b UTSW 11 43,726,794 (GRCm39) missense probably benign 0.13
R7819:Adra1b UTSW 11 43,726,194 (GRCm39) missense probably damaging 1.00
R8289:Adra1b UTSW 11 43,726,315 (GRCm39) missense probably damaging 1.00
R8857:Adra1b UTSW 11 43,727,092 (GRCm39) start gained probably benign
R9098:Adra1b UTSW 11 43,667,218 (GRCm39) missense probably damaging 1.00
R9102:Adra1b UTSW 11 43,667,056 (GRCm39) missense possibly damaging 0.61
R9194:Adra1b UTSW 11 43,726,263 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAATCTGCAAAGCCCTTG -3'
(R):5'- AGTCTACATCGTGGCCAAGAGG -3'

Sequencing Primer
(F):5'- GCCCTTGCAGAACAAATAGTATTATC -3'
(R):5'- ATCGTGGCCAAGAGGACCAC -3'
Posted On 2016-05-10