Incidental Mutation 'R4982:Cntrob'
ID 384934
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Nip2, 9830165K03Rik, Lip8
Accession Numbers
Essential gene? Probably non essential (E-score: 0.175) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 69190313-69214601 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 69202188 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176]
AlphaFold Q8CB62
Predicted Effect possibly damaging
Transcript: ENSMUST00000092973
AA Change: Q468L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: Q468L

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125777
Predicted Effect probably null
Transcript: ENSMUST00000135979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176111
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,348 (GRCm39) I1404L possibly damaging Het
Adra1b A G 11: 43,726,057 (GRCm39) S287P probably damaging Het
Atxn2 G T 5: 121,952,406 (GRCm39) A1280S possibly damaging Het
Bbip1 T C 19: 53,920,639 (GRCm39) probably null Het
Bbs2 A G 8: 94,808,982 (GRCm39) probably null Het
Bcl11b A T 12: 107,932,031 (GRCm39) C180* probably null Het
Bltp3a T C 17: 28,105,580 (GRCm39) F702S probably benign Het
Bod1l A G 5: 41,977,816 (GRCm39) V1166A probably benign Het
Bora C T 14: 99,284,788 (GRCm39) P13S probably damaging Het
C2cd4c T C 10: 79,449,075 (GRCm39) E24G probably benign Het
Ccne1 A T 7: 37,799,996 (GRCm39) I196N probably damaging Het
Chsy3 C T 18: 59,542,647 (GRCm39) S595L probably benign Het
Chsy3 T A 18: 59,542,839 (GRCm39) I659N possibly damaging Het
Col5a2 G A 1: 45,428,618 (GRCm39) P983S possibly damaging Het
Crat T A 2: 30,297,148 (GRCm39) probably null Het
Ctnnbl1 C T 2: 157,678,473 (GRCm39) H359Y probably benign Het
D430041D05Rik A G 2: 104,085,732 (GRCm39) V83A possibly damaging Het
Dixdc1 A G 9: 50,593,902 (GRCm39) S488P possibly damaging Het
Dmrta1 T C 4: 89,576,801 (GRCm39) C86R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Fam171a1 G A 2: 3,179,505 (GRCm39) probably null Het
Fam222b T C 11: 78,045,569 (GRCm39) C249R probably damaging Het
Fbxw18 T A 9: 109,531,719 (GRCm39) probably benign Het
Fes T C 7: 80,036,952 (GRCm39) Y44C probably damaging Het
Gimap6 A G 6: 48,684,933 (GRCm39) V51A probably benign Het
Gpr75 C T 11: 30,841,463 (GRCm39) L123F possibly damaging Het
Gpr75 C A 11: 30,841,462 (GRCm39) H122Q probably damaging Het
Greb1 A G 12: 16,774,762 (GRCm39) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm39) H1041R probably benign Het
Ifna5 A G 4: 88,753,861 (GRCm39) N34D probably damaging Het
Ift140 A T 17: 25,255,968 (GRCm39) H221L probably damaging Het
Igsf3 T C 3: 101,342,983 (GRCm39) V540A probably benign Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Klra2 A T 6: 131,197,152 (GRCm39) D282E probably benign Het
Lyst T A 13: 13,900,539 (GRCm39) H3138Q probably damaging Het
Malrd1 A G 2: 16,046,940 (GRCm39) T1689A probably benign Het
Mon2 A T 10: 122,831,694 (GRCm39) L1671M probably damaging Het
Mpped1 T C 15: 83,720,528 (GRCm39) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm39) H541Q probably benign Het
Muc5ac T A 7: 141,363,193 (GRCm39) probably benign Het
Mybbp1a T C 11: 72,336,040 (GRCm39) I451T probably damaging Het
Myh7 T A 14: 55,210,224 (GRCm39) E1827V probably damaging Het
Or1j14 A T 2: 36,417,409 (GRCm39) probably null Het
Or2h15 A T 17: 38,441,468 (GRCm39) I205N probably damaging Het
Or5p75-ps1 T A 7: 108,107,855 (GRCm39) Y197* probably null Het
Or8b8 C A 9: 37,808,811 (GRCm39) T37N probably damaging Het
Os9 C T 10: 126,956,920 (GRCm39) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm39) L261P probably damaging Het
Pcdhga2 A G 18: 37,802,476 (GRCm39) N107D probably benign Het
Pclo C T 5: 14,729,308 (GRCm39) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phtf1 T A 3: 103,906,024 (GRCm39) S524T probably damaging Het
Pkdrej A C 15: 85,703,197 (GRCm39) L913R probably damaging Het
Pld1 C A 3: 28,085,447 (GRCm39) A201D probably damaging Het
Rorb T A 19: 18,955,052 (GRCm39) Q103L probably benign Het
Sec24d C T 3: 123,093,255 (GRCm39) T284M probably benign Het
Serpinb3b T C 1: 107,085,484 (GRCm39) I86V probably benign Het
Serpinb6a A T 13: 34,102,857 (GRCm39) M201K probably damaging Het
Snx8 A G 5: 140,337,989 (GRCm39) S219P probably benign Het
Sp8 C T 12: 118,812,160 (GRCm39) T5I probably damaging Het
Tanc1 A G 2: 59,630,287 (GRCm39) N749D probably damaging Het
Tarm1 G C 7: 3,537,612 (GRCm39) P284A probably damaging Het
Tbx15 A T 3: 99,161,390 (GRCm39) E65V probably benign Het
Ticam1 T A 17: 56,579,020 (GRCm39) H25L probably benign Het
Tmprss11g T A 5: 86,640,674 (GRCm39) L170F probably damaging Het
Tnfsf9 A G 17: 57,414,504 (GRCm39) *310W probably null Het
Tsks C T 7: 44,593,418 (GRCm39) T128I possibly damaging Het
Vmn1r175 A T 7: 23,508,494 (GRCm39) N44K possibly damaging Het
Vmn1r45 A G 6: 89,910,847 (GRCm39) I41T probably damaging Het
Ythdc2 A G 18: 45,004,532 (GRCm39) N1102S probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69,210,199 (GRCm39) missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69,200,853 (GRCm39) missense possibly damaging 0.90
groats UTSW 11 69,200,317 (GRCm39) nonsense probably null
BB005:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
BB015:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R0270:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69,213,694 (GRCm39) missense probably damaging 1.00
R1749:Cntrob UTSW 11 69,213,700 (GRCm39) missense probably damaging 0.99
R1775:Cntrob UTSW 11 69,211,693 (GRCm39) missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69,198,880 (GRCm39) missense probably benign 0.27
R1967:Cntrob UTSW 11 69,211,789 (GRCm39) missense probably damaging 0.97
R2495:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R3121:Cntrob UTSW 11 69,213,526 (GRCm39) nonsense probably null
R3780:Cntrob UTSW 11 69,193,708 (GRCm39) missense probably damaging 0.97
R4449:Cntrob UTSW 11 69,196,375 (GRCm39) missense probably benign 0.29
R4696:Cntrob UTSW 11 69,211,714 (GRCm39) missense probably damaging 1.00
R4841:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69,206,220 (GRCm39) missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69,211,732 (GRCm39) missense probably damaging 0.97
R5168:Cntrob UTSW 11 69,190,816 (GRCm39) missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69,212,717 (GRCm39) missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69,205,576 (GRCm39) missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69,213,579 (GRCm39) missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69,200,201 (GRCm39) missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69,202,248 (GRCm39) missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69,213,749 (GRCm39) missense probably damaging 0.96
R6964:Cntrob UTSW 11 69,200,317 (GRCm39) nonsense probably null
R7020:Cntrob UTSW 11 69,193,918 (GRCm39) critical splice donor site probably null
R7425:Cntrob UTSW 11 69,205,560 (GRCm39) nonsense probably null
R7928:Cntrob UTSW 11 69,191,121 (GRCm39) missense probably damaging 0.97
R7946:Cntrob UTSW 11 69,206,047 (GRCm39) missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8448:Cntrob UTSW 11 69,190,679 (GRCm39) missense unknown
R8539:Cntrob UTSW 11 69,211,652 (GRCm39) missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69,211,665 (GRCm39) missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69,193,741 (GRCm39) missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69,205,679 (GRCm39) missense probably benign 0.00
R9626:Cntrob UTSW 11 69,202,167 (GRCm39) missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69,213,782 (GRCm39) missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69,212,233 (GRCm39) missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69,202,275 (GRCm39) missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1186:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1187:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1187:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1188:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1188:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1189:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1189:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1190:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1190:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1191:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1191:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Z1192:Cntrob UTSW 11 69,198,882 (GRCm39) missense probably benign 0.23
Z1192:Cntrob UTSW 11 69,196,404 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCATAAGCACTTCGTGGCAAC -3'
(R):5'- GTTGGTCCTTCAGGCAGATGAG -3'

Sequencing Primer
(F):5'- ACTTCGTGGCAACCCTCC -3'
(R):5'- GTTTACATTTCCCACACTTAGAAGAC -3'
Posted On 2016-05-10