Incidental Mutation 'R4982:Cntrob'
ID 384934
Institutional Source Beutler Lab
Gene Symbol Cntrob
Ensembl Gene ENSMUSG00000032782
Gene Name centrobin, centrosomal BRCA2 interacting protein
Synonyms Lip8, 9830165K03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 69299487-69323775 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to A at 69311362 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000092973] [ENSMUST00000123176]
AlphaFold Q8CB62
Predicted Effect possibly damaging
Transcript: ENSMUST00000092973
AA Change: Q468L

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090651
Gene: ENSMUSG00000032782
AA Change: Q468L

DomainStartEndE-ValueType
coiled coil region 191 218 N/A INTRINSIC
coiled coil region 249 557 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125777
Predicted Effect probably null
Transcript: ENSMUST00000135979
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148490
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176111
Predicted Effect probably benign
Transcript: ENSMUST00000176938
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a centrosomal protein that interacts with BRCA2, and is required for centriole duplication and cytokinesis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Cntrob
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02975:Cntrob APN 11 69319373 missense possibly damaging 0.66
IGL03173:Cntrob APN 11 69310027 missense possibly damaging 0.90
groats UTSW 11 69309491 nonsense probably null
BB005:Cntrob UTSW 11 69300295 missense probably damaging 0.97
BB015:Cntrob UTSW 11 69300295 missense probably damaging 0.97
R0270:Cntrob UTSW 11 69311341 missense possibly damaging 0.66
R0501:Cntrob UTSW 11 69322868 missense probably damaging 1.00
R1749:Cntrob UTSW 11 69322874 missense probably damaging 0.99
R1775:Cntrob UTSW 11 69320867 missense possibly damaging 0.90
R1900:Cntrob UTSW 11 69308054 missense probably benign 0.27
R1967:Cntrob UTSW 11 69320963 missense probably damaging 0.97
R2495:Cntrob UTSW 11 69322923 missense probably damaging 0.96
R3121:Cntrob UTSW 11 69322700 nonsense probably null
R3780:Cntrob UTSW 11 69302882 missense probably damaging 0.97
R4449:Cntrob UTSW 11 69305549 missense probably benign 0.29
R4696:Cntrob UTSW 11 69320888 missense probably damaging 1.00
R4841:Cntrob UTSW 11 69315394 missense possibly damaging 0.92
R4842:Cntrob UTSW 11 69315394 missense possibly damaging 0.92
R4908:Cntrob UTSW 11 69320906 missense probably damaging 0.97
R5168:Cntrob UTSW 11 69299990 missense possibly damaging 0.66
R5187:Cntrob UTSW 11 69321891 missense possibly damaging 0.62
R5307:Cntrob UTSW 11 69314750 missense possibly damaging 0.66
R5473:Cntrob UTSW 11 69322753 missense possibly damaging 0.81
R5903:Cntrob UTSW 11 69309375 missense possibly damaging 0.83
R6643:Cntrob UTSW 11 69311422 missense possibly damaging 0.46
R6742:Cntrob UTSW 11 69322923 missense probably damaging 0.96
R6964:Cntrob UTSW 11 69309491 nonsense probably null
R7020:Cntrob UTSW 11 69303092 critical splice donor site probably null
R7425:Cntrob UTSW 11 69314734 nonsense probably null
R7928:Cntrob UTSW 11 69300295 missense probably damaging 0.97
R7946:Cntrob UTSW 11 69315221 missense possibly damaging 0.82
R8348:Cntrob UTSW 11 69299853 missense unknown
R8448:Cntrob UTSW 11 69299853 missense unknown
R8539:Cntrob UTSW 11 69320826 missense possibly damaging 0.94
R9259:Cntrob UTSW 11 69320839 missense possibly damaging 0.81
R9415:Cntrob UTSW 11 69302915 missense possibly damaging 0.66
R9553:Cntrob UTSW 11 69314853 missense probably benign 0.00
R9626:Cntrob UTSW 11 69311341 missense possibly damaging 0.66
R9628:Cntrob UTSW 11 69322956 missense possibly damaging 0.66
R9801:Cntrob UTSW 11 69321407 missense possibly damaging 0.82
Z1177:Cntrob UTSW 11 69311449 missense possibly damaging 0.66
Z1186:Cntrob UTSW 11 69305578 missense probably benign
Z1186:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1187:Cntrob UTSW 11 69305578 missense probably benign
Z1187:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1188:Cntrob UTSW 11 69305578 missense probably benign
Z1188:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1189:Cntrob UTSW 11 69305578 missense probably benign
Z1189:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1190:Cntrob UTSW 11 69305578 missense probably benign
Z1190:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1191:Cntrob UTSW 11 69305578 missense probably benign
Z1191:Cntrob UTSW 11 69308056 missense probably benign 0.23
Z1192:Cntrob UTSW 11 69305578 missense probably benign
Z1192:Cntrob UTSW 11 69308056 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CCATAAGCACTTCGTGGCAAC -3'
(R):5'- GTTGGTCCTTCAGGCAGATGAG -3'

Sequencing Primer
(F):5'- ACTTCGTGGCAACCCTCC -3'
(R):5'- GTTTACATTTCCCACACTTAGAAGAC -3'
Posted On 2016-05-10