Incidental Mutation 'R4982:Sp8'
ID384939
Institutional Source Beutler Lab
Gene Symbol Sp8
Ensembl Gene ENSMUSG00000048562
Gene Nametrans-acting transcription factor 8
SynonymsmBtd, D930049B17Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.758) question?
Stock #R4982 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location118846329-118852576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118848425 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 5 (T5I)
Ref Sequence ENSEMBL: ENSMUSP00000065746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063918] [ENSMUST00000223305]
Predicted Effect probably damaging
Transcript: ENSMUST00000063918
AA Change: T5I

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000065746
Gene: ENSMUSG00000048562
AA Change: T5I

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 36 60 N/A INTRINSIC
low complexity region 95 119 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
ZnF_C2H2 356 380 2.63e0 SMART
ZnF_C2H2 386 410 1.84e-4 SMART
ZnF_C2H2 416 438 7.9e-4 SMART
low complexity region 439 454 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000223305
AA Change: T5I

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SP family transcription factor that in mouse has been shown to be essential for proper limb development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutant fetuses are characterized by truncated limbs, the lack of a tail, and neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Sp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Sp8 APN 12 118848970 missense probably damaging 1.00
IGL01783:Sp8 APN 12 118849024 missense probably benign 0.01
IGL02745:Sp8 APN 12 118849591 missense probably damaging 0.97
R0506:Sp8 UTSW 12 118848565 missense possibly damaging 0.73
R0699:Sp8 UTSW 12 118848820 small deletion probably benign
R1742:Sp8 UTSW 12 118849817 missense probably benign 0.04
R1771:Sp8 UTSW 12 118849567 missense probably damaging 1.00
R1776:Sp8 UTSW 12 118849567 missense probably damaging 1.00
R1791:Sp8 UTSW 12 118849016 missense possibly damaging 0.84
R1926:Sp8 UTSW 12 118849229 missense possibly damaging 0.55
R2159:Sp8 UTSW 12 118848706 missense possibly damaging 0.83
R2223:Sp8 UTSW 12 118849738 missense probably damaging 0.99
R2304:Sp8 UTSW 12 118848569 missense possibly damaging 0.92
R3777:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R3778:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R3779:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R4323:Sp8 UTSW 12 118848436 missense probably benign 0.33
R4360:Sp8 UTSW 12 118848665 missense possibly damaging 0.90
R4428:Sp8 UTSW 12 118849203 missense possibly damaging 0.87
R4883:Sp8 UTSW 12 118849070 missense probably damaging 0.98
R5053:Sp8 UTSW 12 118849604 missense probably damaging 1.00
R5347:Sp8 UTSW 12 118848511 missense possibly damaging 0.91
R5755:Sp8 UTSW 12 118849087 missense probably damaging 0.96
R6219:Sp8 UTSW 12 118848667 missense probably benign 0.27
R7672:Sp8 UTSW 12 118849335 missense possibly damaging 0.47
R7793:Sp8 UTSW 12 118849409 missense probably damaging 0.98
R8548:Sp8 UTSW 12 118849175 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGTGCAGCAGCTAGAGATG -3'
(R):5'- AGCTAAAAGAGTCGGACACC -3'

Sequencing Primer
(F):5'- CAGCAGCTAGAGATGGGGAGC -3'
(R):5'- AGAGTCGGACACCAGGGC -3'
Posted On2016-05-10