Incidental Mutation 'R4982:Serpinb6a'
ID384941
Institutional Source Beutler Lab
Gene Symbol Serpinb6a
Ensembl Gene ENSMUSG00000060147
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 6a
Synonymsovalbumin, D330015H01Rik, 4930482L21Rik, Spi3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4982 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location33917918-34002794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33918874 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 201 (M201K)
Ref Sequence ENSEMBL: ENSMUSP00000132433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017188] [ENSMUST00000043552] [ENSMUST00000076532] [ENSMUST00000167163] [ENSMUST00000167260] [ENSMUST00000168350] [ENSMUST00000171034] [ENSMUST00000171252]
Predicted Effect probably damaging
Transcript: ENSMUST00000017188
AA Change: M222K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000017188
Gene: ENSMUSG00000060147
AA Change: M222K

DomainStartEndE-ValueType
SERPIN 34 399 2.84e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000043552
AA Change: M201K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000041016
Gene: ENSMUSG00000060147
AA Change: M201K

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076532
AA Change: M201K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000075848
Gene: ENSMUSG00000060147
AA Change: M201K

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167163
AA Change: M201K

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131115
Gene: ENSMUSG00000060147
AA Change: M201K

DomainStartEndE-ValueType
SERPIN 13 378 2.84e-179 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167260
SMART Domains Protein: ENSMUSP00000127768
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 193 1.34e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168350
SMART Domains Protein: ENSMUSP00000130356
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 162 9.24e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000171034
AA Change: M201K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132433
Gene: ENSMUSG00000060147
AA Change: M201K

DomainStartEndE-ValueType
SERPIN 13 228 3.54e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171252
SMART Domains Protein: ENSMUSP00000126162
Gene: ENSMUSG00000060147

DomainStartEndE-ValueType
SERPIN 13 188 4.71e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171951
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171985
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin (serine proteinase inhibitor) superfamily, and ovalbumin(ov)-serpin subfamily. It was originally discovered as a placental thrombin inhibitor. The mouse homolog was found to be expressed in the hair cells of the inner ear. Mutations in this gene are associated with nonsyndromic progressive hearing loss, suggesting that this serpin plays an important role in the inner ear in the protection against leakage of lysosomal content during stress, and that loss of this protection results in cell death and sensorineural hearing loss. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a reporter allele are viable, fertile and developmentally normal, with no apparent alterations in growth, leukocyte function, or sensitivity to cerebral ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Serpinb6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Serpinb6a APN 13 33931512 missense possibly damaging 0.54
IGL01356:Serpinb6a APN 13 33925417 missense possibly damaging 0.76
IGL01458:Serpinb6a APN 13 33930081 missense possibly damaging 0.56
IGL01539:Serpinb6a APN 13 33930134 missense probably damaging 1.00
IGL02795:Serpinb6a APN 13 33931593 missense probably damaging 1.00
IGL02885:Serpinb6a APN 13 33918799 missense probably benign 0.11
IGL02971:Serpinb6a APN 13 33931470 critical splice donor site probably null
R0829:Serpinb6a UTSW 13 33935701 utr 5 prime probably benign
R1324:Serpinb6a UTSW 13 33918360 missense probably damaging 1.00
R2232:Serpinb6a UTSW 13 33925320 missense probably damaging 0.97
R3498:Serpinb6a UTSW 13 33918781 missense probably damaging 0.99
R5131:Serpinb6a UTSW 13 33918872 missense probably benign 0.42
R5132:Serpinb6a UTSW 13 33918322 missense probably benign 0.00
R6149:Serpinb6a UTSW 13 33918360 missense probably damaging 1.00
R6427:Serpinb6a UTSW 13 33918259 missense probably damaging 0.99
R6937:Serpinb6a UTSW 13 33918818 missense possibly damaging 0.81
R7806:Serpinb6a UTSW 13 33935565 splice site probably null
R7830:Serpinb6a UTSW 13 33930047 missense probably benign 0.09
R7948:Serpinb6a UTSW 13 33923020 missense probably benign 0.00
R7949:Serpinb6a UTSW 13 33923020 missense probably benign 0.00
R8531:Serpinb6a UTSW 13 33931479 missense probably damaging 0.99
R8773:Serpinb6a UTSW 13 33931560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGATCATGGGAGCCTAGG -3'
(R):5'- AGGCTGATCAAGTATTCTAGAAGTC -3'

Sequencing Primer
(F):5'- CATGGGAGCCTAGGAGAGCTTC -3'
(R):5'- CACTAAATGCCCGTAGTCATGTGG -3'
Posted On2016-05-10