Incidental Mutation 'R4982:Pkdrej'
ID 384946
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Name polycystin (PKD) family receptor for egg jelly
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 85698877-85705934 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 85703197 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Arginine at position 913 (L913R)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000064370
AA Change: L913R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: L913R

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,348 (GRCm39) I1404L possibly damaging Het
Adra1b A G 11: 43,726,057 (GRCm39) S287P probably damaging Het
Atxn2 G T 5: 121,952,406 (GRCm39) A1280S possibly damaging Het
Bbip1 T C 19: 53,920,639 (GRCm39) probably null Het
Bbs2 A G 8: 94,808,982 (GRCm39) probably null Het
Bcl11b A T 12: 107,932,031 (GRCm39) C180* probably null Het
Bltp3a T C 17: 28,105,580 (GRCm39) F702S probably benign Het
Bod1l A G 5: 41,977,816 (GRCm39) V1166A probably benign Het
Bora C T 14: 99,284,788 (GRCm39) P13S probably damaging Het
C2cd4c T C 10: 79,449,075 (GRCm39) E24G probably benign Het
Ccne1 A T 7: 37,799,996 (GRCm39) I196N probably damaging Het
Chsy3 C T 18: 59,542,647 (GRCm39) S595L probably benign Het
Chsy3 T A 18: 59,542,839 (GRCm39) I659N possibly damaging Het
Cntrob T A 11: 69,202,188 (GRCm39) probably null Het
Col5a2 G A 1: 45,428,618 (GRCm39) P983S possibly damaging Het
Crat T A 2: 30,297,148 (GRCm39) probably null Het
Ctnnbl1 C T 2: 157,678,473 (GRCm39) H359Y probably benign Het
D430041D05Rik A G 2: 104,085,732 (GRCm39) V83A possibly damaging Het
Dixdc1 A G 9: 50,593,902 (GRCm39) S488P possibly damaging Het
Dmrta1 T C 4: 89,576,801 (GRCm39) C86R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Fam171a1 G A 2: 3,179,505 (GRCm39) probably null Het
Fam222b T C 11: 78,045,569 (GRCm39) C249R probably damaging Het
Fbxw18 T A 9: 109,531,719 (GRCm39) probably benign Het
Fes T C 7: 80,036,952 (GRCm39) Y44C probably damaging Het
Gimap6 A G 6: 48,684,933 (GRCm39) V51A probably benign Het
Gpr75 C T 11: 30,841,463 (GRCm39) L123F possibly damaging Het
Gpr75 C A 11: 30,841,462 (GRCm39) H122Q probably damaging Het
Greb1 A G 12: 16,774,762 (GRCm39) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm39) H1041R probably benign Het
Ifna5 A G 4: 88,753,861 (GRCm39) N34D probably damaging Het
Ift140 A T 17: 25,255,968 (GRCm39) H221L probably damaging Het
Igsf3 T C 3: 101,342,983 (GRCm39) V540A probably benign Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Klra2 A T 6: 131,197,152 (GRCm39) D282E probably benign Het
Lyst T A 13: 13,900,539 (GRCm39) H3138Q probably damaging Het
Malrd1 A G 2: 16,046,940 (GRCm39) T1689A probably benign Het
Mon2 A T 10: 122,831,694 (GRCm39) L1671M probably damaging Het
Mpped1 T C 15: 83,720,528 (GRCm39) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm39) H541Q probably benign Het
Muc5ac T A 7: 141,363,193 (GRCm39) probably benign Het
Mybbp1a T C 11: 72,336,040 (GRCm39) I451T probably damaging Het
Myh7 T A 14: 55,210,224 (GRCm39) E1827V probably damaging Het
Or1j14 A T 2: 36,417,409 (GRCm39) probably null Het
Or2h15 A T 17: 38,441,468 (GRCm39) I205N probably damaging Het
Or5p75-ps1 T A 7: 108,107,855 (GRCm39) Y197* probably null Het
Or8b8 C A 9: 37,808,811 (GRCm39) T37N probably damaging Het
Os9 C T 10: 126,956,920 (GRCm39) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm39) L261P probably damaging Het
Pcdhga2 A G 18: 37,802,476 (GRCm39) N107D probably benign Het
Pclo C T 5: 14,729,308 (GRCm39) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phtf1 T A 3: 103,906,024 (GRCm39) S524T probably damaging Het
Pld1 C A 3: 28,085,447 (GRCm39) A201D probably damaging Het
Rorb T A 19: 18,955,052 (GRCm39) Q103L probably benign Het
Sec24d C T 3: 123,093,255 (GRCm39) T284M probably benign Het
Serpinb3b T C 1: 107,085,484 (GRCm39) I86V probably benign Het
Serpinb6a A T 13: 34,102,857 (GRCm39) M201K probably damaging Het
Snx8 A G 5: 140,337,989 (GRCm39) S219P probably benign Het
Sp8 C T 12: 118,812,160 (GRCm39) T5I probably damaging Het
Tanc1 A G 2: 59,630,287 (GRCm39) N749D probably damaging Het
Tarm1 G C 7: 3,537,612 (GRCm39) P284A probably damaging Het
Tbx15 A T 3: 99,161,390 (GRCm39) E65V probably benign Het
Ticam1 T A 17: 56,579,020 (GRCm39) H25L probably benign Het
Tmprss11g T A 5: 86,640,674 (GRCm39) L170F probably damaging Het
Tnfsf9 A G 17: 57,414,504 (GRCm39) *310W probably null Het
Tsks C T 7: 44,593,418 (GRCm39) T128I possibly damaging Het
Vmn1r175 A T 7: 23,508,494 (GRCm39) N44K possibly damaging Het
Vmn1r45 A G 6: 89,910,847 (GRCm39) I41T probably damaging Het
Ythdc2 A G 18: 45,004,532 (GRCm39) N1102S probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85,701,427 (GRCm39) missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85,703,857 (GRCm39) missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85,700,360 (GRCm39) missense probably benign 0.22
IGL01461:Pkdrej APN 15 85,704,575 (GRCm39) missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85,702,264 (GRCm39) missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85,701,901 (GRCm39) missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85,705,159 (GRCm39) missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85,700,489 (GRCm39) missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85,699,994 (GRCm39) missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85,705,528 (GRCm39) missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85,702,049 (GRCm39) missense probably benign
IGL02708:Pkdrej APN 15 85,704,988 (GRCm39) missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85,703,895 (GRCm39) missense probably benign 0.41
IGL02741:Pkdrej APN 15 85,701,631 (GRCm39) missense probably benign 0.04
IGL02882:Pkdrej APN 15 85,701,497 (GRCm39) missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85,700,382 (GRCm39) nonsense probably null
IGL03250:Pkdrej APN 15 85,705,556 (GRCm39) missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85,703,881 (GRCm39) small insertion probably benign
FR4737:Pkdrej UTSW 15 85,703,881 (GRCm39) small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85,705,493 (GRCm39) missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85,704,136 (GRCm39) missense probably benign 0.01
R0004:Pkdrej UTSW 15 85,702,384 (GRCm39) missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85,701,746 (GRCm39) nonsense probably null
R0117:Pkdrej UTSW 15 85,700,300 (GRCm39) splice site probably null
R0137:Pkdrej UTSW 15 85,705,768 (GRCm39) missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85,699,831 (GRCm39) missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85,703,752 (GRCm39) missense probably benign 0.08
R0714:Pkdrej UTSW 15 85,699,712 (GRCm39) missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85,702,275 (GRCm39) missense probably benign 0.43
R0750:Pkdrej UTSW 15 85,702,275 (GRCm39) missense probably benign 0.43
R0755:Pkdrej UTSW 15 85,700,336 (GRCm39) missense probably benign 0.00
R0938:Pkdrej UTSW 15 85,702,364 (GRCm39) missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85,700,515 (GRCm39) missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85,702,513 (GRCm39) missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85,703,119 (GRCm39) missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85,701,334 (GRCm39) missense probably benign 0.37
R1510:Pkdrej UTSW 15 85,700,963 (GRCm39) missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85,702,275 (GRCm39) missense probably benign 0.43
R1588:Pkdrej UTSW 15 85,701,442 (GRCm39) missense probably benign 0.44
R1739:Pkdrej UTSW 15 85,704,628 (GRCm39) missense probably benign 0.03
R1779:Pkdrej UTSW 15 85,705,372 (GRCm39) missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85,705,372 (GRCm39) missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85,703,483 (GRCm39) missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85,704,525 (GRCm39) nonsense probably null
R1870:Pkdrej UTSW 15 85,700,632 (GRCm39) missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85,703,368 (GRCm39) missense probably benign 0.00
R2069:Pkdrej UTSW 15 85,705,432 (GRCm39) missense probably benign 0.01
R2113:Pkdrej UTSW 15 85,703,185 (GRCm39) missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85,700,707 (GRCm39) missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85,701,773 (GRCm39) nonsense probably null
R2991:Pkdrej UTSW 15 85,704,137 (GRCm39) missense probably benign 0.00
R3029:Pkdrej UTSW 15 85,701,205 (GRCm39) missense probably benign 0.16
R3162:Pkdrej UTSW 15 85,700,818 (GRCm39) missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85,700,818 (GRCm39) missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85,705,278 (GRCm39) missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85,705,278 (GRCm39) missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85,705,278 (GRCm39) missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85,701,693 (GRCm39) missense probably benign 0.02
R4169:Pkdrej UTSW 15 85,700,515 (GRCm39) missense probably benign 0.24
R4241:Pkdrej UTSW 15 85,702,345 (GRCm39) missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85,702,345 (GRCm39) missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85,705,368 (GRCm39) nonsense probably null
R4939:Pkdrej UTSW 15 85,704,484 (GRCm39) missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85,700,602 (GRCm39) missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85,704,610 (GRCm39) missense probably benign 0.00
R5105:Pkdrej UTSW 15 85,700,585 (GRCm39) missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85,702,528 (GRCm39) missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85,701,319 (GRCm39) missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85,704,638 (GRCm39) missense probably benign
R5909:Pkdrej UTSW 15 85,702,497 (GRCm39) missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85,699,654 (GRCm39) missense probably benign 0.01
R6037:Pkdrej UTSW 15 85,703,967 (GRCm39) missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85,703,967 (GRCm39) missense probably damaging 0.99
R6125:Pkdrej UTSW 15 85,700,585 (GRCm39) missense probably damaging 1.00
R6270:Pkdrej UTSW 15 85,705,306 (GRCm39) nonsense probably null
R6500:Pkdrej UTSW 15 85,703,747 (GRCm39) missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85,701,510 (GRCm39) nonsense probably null
R6786:Pkdrej UTSW 15 85,702,850 (GRCm39) missense probably benign
R6866:Pkdrej UTSW 15 85,705,082 (GRCm39) missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85,702,054 (GRCm39) nonsense probably null
R7086:Pkdrej UTSW 15 85,704,317 (GRCm39) missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85,700,389 (GRCm39) missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85,705,349 (GRCm39) missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85,705,301 (GRCm39) missense probably benign
R7549:Pkdrej UTSW 15 85,703,994 (GRCm39) missense probably damaging 1.00
R7582:Pkdrej UTSW 15 85,703,122 (GRCm39) missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85,699,788 (GRCm39) missense probably benign 0.01
R7791:Pkdrej UTSW 15 85,700,132 (GRCm39) missense possibly damaging 0.87
R7873:Pkdrej UTSW 15 85,700,724 (GRCm39) missense probably benign 0.29
R8121:Pkdrej UTSW 15 85,699,655 (GRCm39) missense probably benign 0.00
R8140:Pkdrej UTSW 15 85,702,611 (GRCm39) missense probably damaging 1.00
R8219:Pkdrej UTSW 15 85,705,493 (GRCm39) missense probably damaging 0.99
R8222:Pkdrej UTSW 15 85,701,640 (GRCm39) missense probably benign
R8432:Pkdrej UTSW 15 85,701,494 (GRCm39) missense probably benign 0.00
R8755:Pkdrej UTSW 15 85,703,807 (GRCm39) missense probably benign 0.00
R8786:Pkdrej UTSW 15 85,704,044 (GRCm39) missense probably benign 0.01
R8817:Pkdrej UTSW 15 85,702,774 (GRCm39) missense probably damaging 1.00
R8827:Pkdrej UTSW 15 85,699,732 (GRCm39) missense possibly damaging 0.76
R8966:Pkdrej UTSW 15 85,702,012 (GRCm39) missense probably damaging 0.99
R8988:Pkdrej UTSW 15 85,700,538 (GRCm39) missense probably damaging 0.99
R9028:Pkdrej UTSW 15 85,701,098 (GRCm39) missense probably damaging 1.00
R9257:Pkdrej UTSW 15 85,700,098 (GRCm39) missense probably damaging 1.00
R9279:Pkdrej UTSW 15 85,700,834 (GRCm39) missense probably damaging 1.00
R9404:Pkdrej UTSW 15 85,703,270 (GRCm39) missense probably benign 0.39
R9433:Pkdrej UTSW 15 85,704,070 (GRCm39) missense probably benign 0.03
R9454:Pkdrej UTSW 15 85,702,420 (GRCm39) missense probably benign 0.05
R9479:Pkdrej UTSW 15 85,699,571 (GRCm39) missense possibly damaging 0.64
R9720:Pkdrej UTSW 15 85,702,497 (GRCm39) missense possibly damaging 0.82
R9748:Pkdrej UTSW 15 85,704,871 (GRCm39) missense possibly damaging 0.91
R9760:Pkdrej UTSW 15 85,705,268 (GRCm39) missense probably benign 0.30
Z1177:Pkdrej UTSW 15 85,700,738 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACTAGCTTGTTAGTGGGC -3'
(R):5'- CGAGTTTTAACCTTACGGTGGG -3'

Sequencing Primer
(F):5'- CTTGTTAGTGGGCTTCAGGACAAAAC -3'
(R):5'- TTTAACCTTACGGTGGGACCCG -3'
Posted On 2016-05-10