Incidental Mutation 'R4982:Ift140'
ID 384949
Institutional Source Beutler Lab
Gene Symbol Ift140
Ensembl Gene ENSMUSG00000024169
Gene Name intraflagellar transport 140
Synonyms Tce5, Wdtc2
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 25235056-25318461 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25255968 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 221 (H221L)
Ref Sequence ENSEMBL: ENSMUSP00000116689 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024983] [ENSMUST00000137386] [ENSMUST00000156945]
AlphaFold E9PY46
Predicted Effect possibly damaging
Transcript: ENSMUST00000024983
AA Change: H490L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000024983
Gene: ENSMUSG00000024169
AA Change: H490L

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 8e-17 BLAST
Blast:WD40 510 547 6e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 9e-13 BLAST
Blast:TPR 1011 1044 1e-13 BLAST
Blast:TPR 1377 1410 8e-13 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000137386
AA Change: H490L

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116163
Gene: ENSMUSG00000024169
AA Change: H490L

DomainStartEndE-ValueType
WD40 55 89 6.14e1 SMART
WD40 91 131 1.49e0 SMART
Blast:WD40 252 304 3e-15 BLAST
WD40 308 352 2.76e0 SMART
Blast:WD40 364 405 1e-16 BLAST
Blast:WD40 510 547 5e-13 BLAST
Blast:WD40 560 603 3e-7 BLAST
Blast:TPR 863 896 8e-13 BLAST
Blast:TPR 1011 1044 9e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142000
Predicted Effect probably damaging
Transcript: ENSMUST00000156945
AA Change: H221L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116689
Gene: ENSMUSG00000024169
AA Change: H221L

DomainStartEndE-ValueType
Blast:WD40 2 35 6e-12 BLAST
SCOP:d1erja_ 19 131 5e-7 SMART
Blast:WD40 39 83 1e-24 BLAST
Blast:WD40 95 136 2e-18 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the subunits of the intraflagellar transport (IFT) complex A. Intraflagellar transport is involved in the genesis, resorption and signaling of primary cilia. The primary cilium is a microtubule-based sensory organelle at the surface of most quiescent mammalian cells, that receives signals from its environment, such as the flow of fluid, light or odors, and transduces those signals to the nucleus. Loss of the corresponding protein in mouse results in renal cystic disease. [provided by RefSeq, Jun 2012]
PHENOTYPE: Mice homozygous for a reporter knock-out allele die at mid-gestation. Mice homozygous for an ENU-induced mutation exhibit cardiovascular defects and situs abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,348 (GRCm39) I1404L possibly damaging Het
Adra1b A G 11: 43,726,057 (GRCm39) S287P probably damaging Het
Atxn2 G T 5: 121,952,406 (GRCm39) A1280S possibly damaging Het
Bbip1 T C 19: 53,920,639 (GRCm39) probably null Het
Bbs2 A G 8: 94,808,982 (GRCm39) probably null Het
Bcl11b A T 12: 107,932,031 (GRCm39) C180* probably null Het
Bltp3a T C 17: 28,105,580 (GRCm39) F702S probably benign Het
Bod1l A G 5: 41,977,816 (GRCm39) V1166A probably benign Het
Bora C T 14: 99,284,788 (GRCm39) P13S probably damaging Het
C2cd4c T C 10: 79,449,075 (GRCm39) E24G probably benign Het
Ccne1 A T 7: 37,799,996 (GRCm39) I196N probably damaging Het
Chsy3 C T 18: 59,542,647 (GRCm39) S595L probably benign Het
Chsy3 T A 18: 59,542,839 (GRCm39) I659N possibly damaging Het
Cntrob T A 11: 69,202,188 (GRCm39) probably null Het
Col5a2 G A 1: 45,428,618 (GRCm39) P983S possibly damaging Het
Crat T A 2: 30,297,148 (GRCm39) probably null Het
Ctnnbl1 C T 2: 157,678,473 (GRCm39) H359Y probably benign Het
D430041D05Rik A G 2: 104,085,732 (GRCm39) V83A possibly damaging Het
Dixdc1 A G 9: 50,593,902 (GRCm39) S488P possibly damaging Het
Dmrta1 T C 4: 89,576,801 (GRCm39) C86R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Fam171a1 G A 2: 3,179,505 (GRCm39) probably null Het
Fam222b T C 11: 78,045,569 (GRCm39) C249R probably damaging Het
Fbxw18 T A 9: 109,531,719 (GRCm39) probably benign Het
Fes T C 7: 80,036,952 (GRCm39) Y44C probably damaging Het
Gimap6 A G 6: 48,684,933 (GRCm39) V51A probably benign Het
Gpr75 C T 11: 30,841,463 (GRCm39) L123F possibly damaging Het
Gpr75 C A 11: 30,841,462 (GRCm39) H122Q probably damaging Het
Greb1 A G 12: 16,774,762 (GRCm39) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm39) H1041R probably benign Het
Ifna5 A G 4: 88,753,861 (GRCm39) N34D probably damaging Het
Igsf3 T C 3: 101,342,983 (GRCm39) V540A probably benign Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Klra2 A T 6: 131,197,152 (GRCm39) D282E probably benign Het
Lyst T A 13: 13,900,539 (GRCm39) H3138Q probably damaging Het
Malrd1 A G 2: 16,046,940 (GRCm39) T1689A probably benign Het
Mon2 A T 10: 122,831,694 (GRCm39) L1671M probably damaging Het
Mpped1 T C 15: 83,720,528 (GRCm39) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm39) H541Q probably benign Het
Muc5ac T A 7: 141,363,193 (GRCm39) probably benign Het
Mybbp1a T C 11: 72,336,040 (GRCm39) I451T probably damaging Het
Myh7 T A 14: 55,210,224 (GRCm39) E1827V probably damaging Het
Or1j14 A T 2: 36,417,409 (GRCm39) probably null Het
Or2h15 A T 17: 38,441,468 (GRCm39) I205N probably damaging Het
Or5p75-ps1 T A 7: 108,107,855 (GRCm39) Y197* probably null Het
Or8b8 C A 9: 37,808,811 (GRCm39) T37N probably damaging Het
Os9 C T 10: 126,956,920 (GRCm39) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm39) L261P probably damaging Het
Pcdhga2 A G 18: 37,802,476 (GRCm39) N107D probably benign Het
Pclo C T 5: 14,729,308 (GRCm39) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phtf1 T A 3: 103,906,024 (GRCm39) S524T probably damaging Het
Pkdrej A C 15: 85,703,197 (GRCm39) L913R probably damaging Het
Pld1 C A 3: 28,085,447 (GRCm39) A201D probably damaging Het
Rorb T A 19: 18,955,052 (GRCm39) Q103L probably benign Het
Sec24d C T 3: 123,093,255 (GRCm39) T284M probably benign Het
Serpinb3b T C 1: 107,085,484 (GRCm39) I86V probably benign Het
Serpinb6a A T 13: 34,102,857 (GRCm39) M201K probably damaging Het
Snx8 A G 5: 140,337,989 (GRCm39) S219P probably benign Het
Sp8 C T 12: 118,812,160 (GRCm39) T5I probably damaging Het
Tanc1 A G 2: 59,630,287 (GRCm39) N749D probably damaging Het
Tarm1 G C 7: 3,537,612 (GRCm39) P284A probably damaging Het
Tbx15 A T 3: 99,161,390 (GRCm39) E65V probably benign Het
Ticam1 T A 17: 56,579,020 (GRCm39) H25L probably benign Het
Tmprss11g T A 5: 86,640,674 (GRCm39) L170F probably damaging Het
Tnfsf9 A G 17: 57,414,504 (GRCm39) *310W probably null Het
Tsks C T 7: 44,593,418 (GRCm39) T128I possibly damaging Het
Vmn1r175 A T 7: 23,508,494 (GRCm39) N44K possibly damaging Het
Vmn1r45 A G 6: 89,910,847 (GRCm39) I41T probably damaging Het
Ythdc2 A G 18: 45,004,532 (GRCm39) N1102S probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Ift140
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00753:Ift140 APN 17 25,274,618 (GRCm39) missense probably damaging 1.00
IGL00966:Ift140 APN 17 25,237,776 (GRCm39) missense probably damaging 1.00
IGL01082:Ift140 APN 17 25,267,429 (GRCm39) missense possibly damaging 0.89
IGL01394:Ift140 APN 17 25,313,676 (GRCm39) missense probably benign 0.02
IGL01816:Ift140 APN 17 25,305,999 (GRCm39) splice site probably null
IGL01994:Ift140 APN 17 25,267,417 (GRCm39) missense probably damaging 1.00
IGL02102:Ift140 APN 17 25,252,104 (GRCm39) missense probably benign 0.03
IGL02207:Ift140 APN 17 25,274,572 (GRCm39) missense probably benign
IGL02493:Ift140 APN 17 25,306,898 (GRCm39) nonsense probably null
IGL02735:Ift140 APN 17 25,253,009 (GRCm39) splice site probably benign
IGL02902:Ift140 APN 17 25,309,736 (GRCm39) missense probably damaging 1.00
IGL03037:Ift140 APN 17 25,311,368 (GRCm39) missense probably benign 0.02
IGL03122:Ift140 APN 17 25,305,884 (GRCm39) missense probably damaging 1.00
IGL03206:Ift140 APN 17 25,311,800 (GRCm39) missense probably damaging 0.98
IGL03271:Ift140 APN 17 25,306,880 (GRCm39) missense probably damaging 1.00
IGL03358:Ift140 APN 17 25,306,958 (GRCm39) missense probably damaging 1.00
PIT4515001:Ift140 UTSW 17 25,305,834 (GRCm39) missense probably damaging 0.98
R0100:Ift140 UTSW 17 25,309,928 (GRCm39) nonsense probably null
R0100:Ift140 UTSW 17 25,309,928 (GRCm39) nonsense probably null
R0197:Ift140 UTSW 17 25,309,907 (GRCm39) missense probably benign 0.09
R0238:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0238:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0239:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0239:Ift140 UTSW 17 25,264,497 (GRCm39) nonsense probably null
R0355:Ift140 UTSW 17 25,267,409 (GRCm39) nonsense probably null
R0399:Ift140 UTSW 17 25,269,314 (GRCm39) missense possibly damaging 0.77
R0574:Ift140 UTSW 17 25,270,734 (GRCm39) splice site probably null
R0610:Ift140 UTSW 17 25,254,777 (GRCm39) missense probably benign 0.06
R0701:Ift140 UTSW 17 25,309,907 (GRCm39) missense probably benign 0.09
R0883:Ift140 UTSW 17 25,309,907 (GRCm39) missense probably benign 0.09
R0900:Ift140 UTSW 17 25,254,786 (GRCm39) missense probably benign 0.22
R1167:Ift140 UTSW 17 25,254,719 (GRCm39) missense probably benign 0.01
R1295:Ift140 UTSW 17 25,307,907 (GRCm39) critical splice donor site probably null
R1588:Ift140 UTSW 17 25,306,959 (GRCm39) missense probably damaging 1.00
R1619:Ift140 UTSW 17 25,307,839 (GRCm39) missense probably damaging 1.00
R1637:Ift140 UTSW 17 25,244,608 (GRCm39) missense probably benign 0.40
R1854:Ift140 UTSW 17 25,254,813 (GRCm39) missense probably benign 0.05
R2397:Ift140 UTSW 17 25,239,710 (GRCm39) missense probably damaging 1.00
R2510:Ift140 UTSW 17 25,255,282 (GRCm39) missense probably benign 0.02
R2918:Ift140 UTSW 17 25,254,805 (GRCm39) missense possibly damaging 0.66
R3433:Ift140 UTSW 17 25,255,282 (GRCm39) missense probably benign 0.02
R3878:Ift140 UTSW 17 25,247,918 (GRCm39) missense probably benign 0.25
R4559:Ift140 UTSW 17 25,309,741 (GRCm39) missense probably damaging 0.97
R4670:Ift140 UTSW 17 25,317,935 (GRCm39) unclassified probably benign
R4711:Ift140 UTSW 17 25,313,691 (GRCm39) splice site probably null
R4934:Ift140 UTSW 17 25,267,462 (GRCm39) missense probably benign
R4949:Ift140 UTSW 17 25,313,639 (GRCm39) missense probably benign 0.06
R5099:Ift140 UTSW 17 25,309,674 (GRCm39) missense probably damaging 1.00
R5223:Ift140 UTSW 17 25,254,786 (GRCm39) missense probably benign 0.22
R5268:Ift140 UTSW 17 25,239,601 (GRCm39) missense possibly damaging 0.48
R5423:Ift140 UTSW 17 25,252,059 (GRCm39) missense probably damaging 0.96
R5480:Ift140 UTSW 17 25,239,550 (GRCm39) missense probably damaging 1.00
R5655:Ift140 UTSW 17 25,264,038 (GRCm39) missense probably damaging 1.00
R5756:Ift140 UTSW 17 25,247,787 (GRCm39) missense possibly damaging 0.62
R5837:Ift140 UTSW 17 25,308,514 (GRCm39) missense probably damaging 1.00
R5894:Ift140 UTSW 17 25,252,893 (GRCm39) missense possibly damaging 0.92
R5907:Ift140 UTSW 17 25,311,345 (GRCm39) missense probably benign 0.02
R5966:Ift140 UTSW 17 25,313,735 (GRCm39) nonsense probably null
R6000:Ift140 UTSW 17 25,255,934 (GRCm39) missense probably benign 0.00
R6046:Ift140 UTSW 17 25,274,563 (GRCm39) missense probably benign 0.00
R6050:Ift140 UTSW 17 25,309,979 (GRCm39) missense probably damaging 1.00
R6103:Ift140 UTSW 17 25,312,100 (GRCm39) missense probably damaging 1.00
R6239:Ift140 UTSW 17 25,247,946 (GRCm39) missense probably benign 0.26
R6287:Ift140 UTSW 17 25,269,408 (GRCm39) missense probably benign
R6539:Ift140 UTSW 17 25,313,643 (GRCm39) missense possibly damaging 0.87
R6656:Ift140 UTSW 17 25,251,147 (GRCm39) missense probably damaging 0.96
R6723:Ift140 UTSW 17 25,252,090 (GRCm39) missense probably benign 0.08
R6749:Ift140 UTSW 17 25,317,890 (GRCm39) missense probably damaging 0.99
R6892:Ift140 UTSW 17 25,239,520 (GRCm39) missense possibly damaging 0.95
R7151:Ift140 UTSW 17 25,274,699 (GRCm39) missense probably damaging 1.00
R7235:Ift140 UTSW 17 25,239,619 (GRCm39) missense possibly damaging 0.88
R7424:Ift140 UTSW 17 25,256,010 (GRCm39) missense possibly damaging 0.81
R7552:Ift140 UTSW 17 25,252,089 (GRCm39) missense probably benign 0.02
R7560:Ift140 UTSW 17 25,311,315 (GRCm39) missense probably benign 0.28
R7660:Ift140 UTSW 17 25,270,798 (GRCm39) missense probably damaging 1.00
R8105:Ift140 UTSW 17 25,255,949 (GRCm39) missense probably benign 0.01
R8415:Ift140 UTSW 17 25,311,889 (GRCm39) missense probably damaging 0.99
R8437:Ift140 UTSW 17 25,313,651 (GRCm39) missense probably damaging 0.99
R8747:Ift140 UTSW 17 25,254,809 (GRCm39) missense probably benign
R8932:Ift140 UTSW 17 25,305,862 (GRCm39) missense probably benign 0.03
R9226:Ift140 UTSW 17 25,317,839 (GRCm39) missense probably benign 0.00
R9347:Ift140 UTSW 17 25,313,753 (GRCm39) missense probably benign 0.00
R9451:Ift140 UTSW 17 25,252,925 (GRCm39) missense probably benign 0.33
R9456:Ift140 UTSW 17 25,254,758 (GRCm39) missense probably benign 0.03
R9782:Ift140 UTSW 17 25,264,151 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTGGAACTCTGTACAAGACTC -3'
(R):5'- TTTCCTCCCCTGGACAGTCAAG -3'

Sequencing Primer
(F):5'- TACAAGACTCAGGTAAGATGGTCTC -3'
(R):5'- GGACCGTCTCCCTGAAAAAGG -3'
Posted On 2016-05-10