Incidental Mutation 'R4982:Ticam1'
ID384952
Institutional Source Beutler Lab
Gene Symbol Ticam1
Ensembl Gene ENSMUSG00000047123
Gene Nametoll-like receptor adaptor molecule 1
SynonymsTICAM-1, Trif
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4982 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56269319-56276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56272020 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 25 (H25L)
Ref Sequence ENSEMBL: ENSMUSP00000055104 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058136]
Predicted Effect probably benign
Transcript: ENSMUST00000058136
AA Change: H25L

PolyPhen 2 Score 0.104 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000055104
Gene: ENSMUSG00000047123
AA Change: H25L

DomainStartEndE-ValueType
PDB:4BSX|D 5 153 3e-52 PDB
low complexity region 345 384 N/A INTRINSIC
SCOP:d1fyva_ 386 491 8e-3 SMART
PDB:2M1X|A 391 547 1e-74 PDB
Pfam:RHIM 610 698 4.7e-13 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adaptor protein containing a Toll/interleukin-1 receptor (TIR) homology domain, which is an intracellular signaling domain that mediates protein-protein interactions between the Toll-like receptors (TLRs) and signal-transduction components. This protein is involved in native immunity against invading pathogens. It specifically interacts with toll-like receptor 3, but not with other TLRs, and this association mediates dsRNA induction of interferon-beta through activation of nuclear factor kappa-B, during an antiviral immune response. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous null mice are viable but exhibit abnormalities of the innate immune system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Chsy3 C T 18: 59,409,575 S595L probably benign Het
Chsy3 T A 18: 59,409,767 I659N possibly damaging Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Ticam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02160:Ticam1 APN 17 56270560 missense possibly damaging 0.80
IGL02164:Ticam1 APN 17 56270019 missense unknown
Lps2 UTSW 17 56271576 small deletion
Pangu UTSW 17 56276693 critical splice donor site probably benign
Yue UTSW 17 56271339 missense probably benign 0.06
R0930:Ticam1 UTSW 17 56270226 missense unknown
R0930:Ticam1 UTSW 17 56271687 missense probably damaging 1.00
R1509:Ticam1 UTSW 17 56271113 missense probably benign 0.43
R1837:Ticam1 UTSW 17 56270799 missense possibly damaging 0.87
R1863:Ticam1 UTSW 17 56271436 missense probably damaging 1.00
R1867:Ticam1 UTSW 17 56271718 missense probably benign 0.01
R1872:Ticam1 UTSW 17 56271897 missense probably benign 0.00
R1893:Ticam1 UTSW 17 56271894 missense probably benign 0.36
R1980:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1981:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R1982:Ticam1 UTSW 17 56271555 missense probably damaging 0.99
R2263:Ticam1 UTSW 17 56271888 missense possibly damaging 0.95
R2513:Ticam1 UTSW 17 56271612 missense possibly damaging 0.61
R4294:Ticam1 UTSW 17 56271339 missense probably benign 0.06
R4888:Ticam1 UTSW 17 56271642 missense probably damaging 0.98
R5396:Ticam1 UTSW 17 56271117 missense probably benign 0.02
R5604:Ticam1 UTSW 17 56271756 missense probably benign 0.13
R5641:Ticam1 UTSW 17 56270629 frame shift probably null
R5647:Ticam1 UTSW 17 56270629 frame shift probably null
R5648:Ticam1 UTSW 17 56270629 frame shift probably null
R5657:Ticam1 UTSW 17 56270629 frame shift probably null
R5770:Ticam1 UTSW 17 56270629 frame shift probably null
R5771:Ticam1 UTSW 17 56270629 frame shift probably null
R5964:Ticam1 UTSW 17 56271703 missense probably damaging 0.99
R5974:Ticam1 UTSW 17 56271178 missense probably benign
R6217:Ticam1 UTSW 17 56270730 missense probably damaging 1.00
R6983:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6984:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6985:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6986:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6987:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6988:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R6989:Ticam1 UTSW 17 56269900 missense probably benign 0.00
R7029:Ticam1 UTSW 17 56271154 missense possibly damaging 0.51
V8831:Ticam1 UTSW 17 56269969 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AAGCCATGTCCCTTGTGGAG -3'
(R):5'- AACTCCTACTCCTGCAGGTC -3'

Sequencing Primer
(F):5'- ACAAGTCTGGAGGCTCCTCAG -3'
(R):5'- ACTCCTGCAGGTCTGTGCTG -3'
Posted On2016-05-10