Mutagenetix > Incidental Mutation

Incidental Mutation 'R4982:Ythdc2'

384956

Institutional Source

Beutler Lab

Gene Symbol

Ythdc2

Ensembl Gene

ENSMUSG00000034653

Gene Name

YTH domain containing 2

Synonyms

3010002F02Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4982 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44827746-44889724 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44871465 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1102 (N1102S)

Ref Sequence

ENSEMBL: ENSMUSP00000048340 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037763] [ENSMUST00000201507]

AlphaFold

B2RR83

Predicted Effect

probably benign
Transcript: ENSMUST00000037763
AA Change: N1102S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000048340
Gene: ENSMUSG00000034653
AA Change: N1102S

Domain	Start	End	E-Value	Type
low complexity region	2	50	N/A	INTRINSIC
Pfam:R3H	59	119	1.7e-15	PFAM
DEXDc	206	393	4.95e-26	SMART
low complexity region	413	428	N/A	INTRINSIC
ANK	521	550	2.79e1	SMART
ANK	554	583	1.5e2	SMART
HELICc	648	759	5.31e-17	SMART
HA2	823	916	2.58e-22	SMART
Pfam:OB_NTP_bind	953	1082	1.3e-18	PFAM
low complexity region	1263	1299	N/A	INTRINSIC
Pfam:YTH	1303	1434	7.2e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201507
AA Change: N447S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000144479
Gene: ENSMUSG00000034653
AA Change: N447S

Domain	Start	End	E-Value	Type
HELICc	5	104	9.1e-19	SMART
HA2	168	261	2e-26	SMART
Pfam:OB_NTP_bind	298	427	6e-16	PFAM
low complexity region	570	582	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DEAH (Asp-Glu-Ala-His) subfamily of proteins, part of the DEAD (Asp-Glu-Ala-Asp) box family of RNA helicases. The encoded protein binds to N6-methyladenosine, a common modified RNA nucleotide that is enriched in the stop codons and 3' UTRs of eukaryotic messenger RNAs. Binding of proteins to this modified nucleotide may regulate mRNA translation and stability. This gene may be associated with susceptibility to pancreatic cancer in human patients, and knockdown of this gene resulted in reduced proliferation in a human liver cancer cell line. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit female and male infertility with arrested meiosis and small gonads. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,292,348	I1404L	possibly damaging	Het
Adra1b	A	G	11: 43,835,230	S287P	probably damaging	Het
Atxn2	G	T	5: 121,814,343	A1280S	possibly damaging	Het
Bbip1	T	C	19: 53,932,208		probably null	Het
Bbs2	A	G	8: 94,082,354		probably null	Het
Bcl11b	A	T	12: 107,965,772	C180*	probably null	Het
Bod1l	A	G	5: 41,820,473	V1166A	probably benign	Het
Bora	C	T	14: 99,047,352	P13S	probably damaging	Het
C2cd4c	T	C	10: 79,613,241	E24G	probably benign	Het
Ccne1	A	T	7: 38,100,571	I196N	probably damaging	Het
Chsy3	C	T	18: 59,409,575	S595L	probably benign	Het
Chsy3	T	A	18: 59,409,767	I659N	possibly damaging	Het
Cntrob	T	A	11: 69,311,362		probably null	Het
Col5a2	G	A	1: 45,389,458	P983S	possibly damaging	Het
Crat	T	A	2: 30,407,136		probably null	Het
Ctnnbl1	C	T	2: 157,836,553	H359Y	probably benign	Het
D430041D05Rik	A	G	2: 104,255,387	V83A	possibly damaging	Het
Dixdc1	A	G	9: 50,682,602	S488P	possibly damaging	Het
Dmrta1	T	C	4: 89,688,564	C86R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Homo
Fam171a1	G	A	2: 3,178,468		probably null	Het
Fam222b	T	C	11: 78,154,743	C249R	probably damaging	Het
Fbxw18	T	A	9: 109,702,651		probably benign	Het
Fes	T	C	7: 80,387,204	Y44C	probably damaging	Het
Gimap6	A	G	6: 48,707,999	V51A	probably benign	Het
Gpr75	C	A	11: 30,891,462	H122Q	probably damaging	Het
Gpr75	C	T	11: 30,891,463	L123F	possibly damaging	Het
Greb1	A	G	12: 16,724,761	S212P	probably damaging	Het
Grin3a	T	C	4: 49,665,512	H1041R	probably benign	Het
Ifna5	A	G	4: 88,835,624	N34D	probably damaging	Het
Ift140	A	T	17: 25,036,994	H221L	probably damaging	Het
Igsf3	T	C	3: 101,435,667	V540A	probably benign	Het
Il10ra	A	G	9: 45,269,059	L5S	probably damaging	Het
Klra2	A	T	6: 131,220,189	D282E	probably benign	Het
Lyst	T	A	13: 13,725,954	H3138Q	probably damaging	Het
Malrd1	A	G	2: 16,042,129	T1689A	probably benign	Het
Mon2	A	T	10: 122,995,789	L1671M	probably damaging	Het
Mpped1	T	C	15: 83,836,327	F71S	probably damaging	Het
Mtpap	C	A	18: 4,396,332	H541Q	probably benign	Het
Muc5ac	T	A	7: 141,809,456		probably benign	Het
Mybbp1a	T	C	11: 72,445,214	I451T	probably damaging	Het
Myh7	T	A	14: 54,972,767	E1827V	probably damaging	Het
Olfr132	A	T	17: 38,130,577	I205N	probably damaging	Het
Olfr145	C	A	9: 37,897,515	T37N	probably damaging	Het
Olfr342	A	T	2: 36,527,397		probably null	Het
Olfr501-ps1	T	A	7: 108,508,648	Y197*	probably null	Het
Os9	C	T	10: 127,121,051	R23H	possibly damaging	Het
Otud6b	A	G	4: 14,815,607	L261P	probably damaging	Het
Pcdhga2	A	G	18: 37,669,423	N107D	probably benign	Het
Pclo	C	T	5: 14,679,294		probably benign	Het
Peg10	T	TCCG	6: 4,756,451		probably benign	Het
Phtf1	T	A	3: 103,998,708	S524T	probably damaging	Het
Pkdrej	A	C	15: 85,818,996	L913R	probably damaging	Het
Pld1	C	A	3: 28,031,298	A201D	probably damaging	Het
Rorb	T	A	19: 18,977,688	Q103L	probably benign	Het
Sec24d	C	T	3: 123,299,606	T284M	probably benign	Het
Serpinb3b	T	C	1: 107,157,754	I86V	probably benign	Het
Serpinb6a	A	T	13: 33,918,874	M201K	probably damaging	Het
Snx8	A	G	5: 140,352,234	S219P	probably benign	Het
Sp8	C	T	12: 118,848,425	T5I	probably damaging	Het
Tanc1	A	G	2: 59,799,943	N749D	probably damaging	Het
Tarm1	G	C	7: 3,489,096	P284A	probably damaging	Het
Tbx15	A	T	3: 99,254,074	E65V	probably benign	Het
Ticam1	T	A	17: 56,272,020	H25L	probably benign	Het
Tmprss11g	T	A	5: 86,492,815	L170F	probably damaging	Het
Tnfsf9	A	G	17: 57,107,504	*310W	probably null	Het
Tsks	C	T	7: 44,943,994	T128I	possibly damaging	Het
Uhrf1bp1	T	C	17: 27,886,606	F702S	probably benign	Het
Vmn1r175	A	T	7: 23,809,069	N44K	possibly damaging	Het
Vmn1r45	A	G	6: 89,933,865	I41T	probably damaging	Het
Zswim4	C	T	8: 84,226,667		probably null	Het

Other mutations in Ythdc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Ythdc2	APN	18	44859973	missense	probably benign
IGL00341:Ythdc2	APN	18	44850397	missense	probably benign	0.00
IGL00502:Ythdc2	APN	18	44847812	missense	probably damaging	0.99
IGL00585:Ythdc2	APN	18	44864361	missense	probably damaging	1.00
IGL01081:Ythdc2	APN	18	44850659	missense	probably benign	0.19
IGL01569:Ythdc2	APN	18	44887651	missense	probably benign
IGL01577:Ythdc2	APN	18	44858282	missense	probably benign	0.00
IGL01617:Ythdc2	APN	18	44841415	missense	possibly damaging	0.53
IGL01674:Ythdc2	APN	18	44860404	missense	probably benign	0.04
IGL01736:Ythdc2	APN	18	44850668	missense	probably damaging	0.97
IGL02095:Ythdc2	APN	18	44873140	splice site	probably benign
IGL02245:Ythdc2	APN	18	44862684	missense	possibly damaging	0.74
IGL02524:Ythdc2	APN	18	44847854	missense	probably damaging	0.98
IGL02542:Ythdc2	APN	18	44840241	missense	probably damaging	1.00
IGL02622:Ythdc2	APN	18	44859934	missense	probably damaging	0.99
IGL02795:Ythdc2	APN	18	44837438	missense	possibly damaging	0.95
IGL02935:Ythdc2	APN	18	44855045	missense	probably damaging	1.00
PIT4618001:Ythdc2	UTSW	18	44834598	missense	probably benign	0.19
R0115:Ythdc2	UTSW	18	44841423	splice site	probably benign
R0329:Ythdc2	UTSW	18	44865060	splice site	probably benign
R0472:Ythdc2	UTSW	18	44864357	missense	probably benign	0.02
R0530:Ythdc2	UTSW	18	44850398	missense	probably damaging	0.99
R0547:Ythdc2	UTSW	18	44840264	missense	possibly damaging	0.92
R0563:Ythdc2	UTSW	18	44864848	splice site	probably benign
R0609:Ythdc2	UTSW	18	44864357	missense	probably benign	0.02
R1291:Ythdc2	UTSW	18	44855209	missense	probably benign	0.33
R1469:Ythdc2	UTSW	18	44864462	missense	probably benign	0.00
R1469:Ythdc2	UTSW	18	44864462	missense	probably benign	0.00
R1724:Ythdc2	UTSW	18	44828690	missense	probably benign	0.04
R1860:Ythdc2	UTSW	18	44872956	missense	possibly damaging	0.86
R2040:Ythdc2	UTSW	18	44855174	nonsense	probably null
R2308:Ythdc2	UTSW	18	44847748	missense	possibly damaging	0.95
R3711:Ythdc2	UTSW	18	44833173	missense	probably damaging	0.98
R4005:Ythdc2	UTSW	18	44833128	missense	probably benign	0.00
R4580:Ythdc2	UTSW	18	44858198	missense	possibly damaging	0.81
R4631:Ythdc2	UTSW	18	44887631	missense	probably benign	0.03
R4815:Ythdc2	UTSW	18	44885240	missense	probably benign	0.40
R4924:Ythdc2	UTSW	18	44847804	missense	probably damaging	1.00
R5011:Ythdc2	UTSW	18	44854742	missense	probably benign	0.38
R5141:Ythdc2	UTSW	18	44865047	missense	probably benign	0.01
R5147:Ythdc2	UTSW	18	44844292	missense	probably damaging	0.98
R5280:Ythdc2	UTSW	18	44860621	missense	probably damaging	1.00
R5388:Ythdc2	UTSW	18	44857025	missense	possibly damaging	0.65
R5928:Ythdc2	UTSW	18	44833205	missense	probably benign
R5931:Ythdc2	UTSW	18	44872956	missense	possibly damaging	0.86
R5995:Ythdc2	UTSW	18	44886253	missense	probably damaging	1.00
R6027:Ythdc2	UTSW	18	44860436	missense	probably benign	0.02
R6056:Ythdc2	UTSW	18	44840210	missense	probably damaging	0.98
R6318:Ythdc2	UTSW	18	44860377	missense	probably benign	0.04
R6399:Ythdc2	UTSW	18	44886402	missense	possibly damaging	0.93
R6586:Ythdc2	UTSW	18	44845788	missense	probably benign	0.00
R6684:Ythdc2	UTSW	18	44873069	missense	possibly damaging	0.47
R7040:Ythdc2	UTSW	18	44834462	missense	probably benign	0.02
R7071:Ythdc2	UTSW	18	44845788	missense	probably benign	0.00
R7105:Ythdc2	UTSW	18	44834563	missense	probably damaging	1.00
R7148:Ythdc2	UTSW	18	44833122	missense	probably benign	0.42
R7290:Ythdc2	UTSW	18	44837491	missense	possibly damaging	0.50
R7806:Ythdc2	UTSW	18	44844286	missense	possibly damaging	0.91
R7806:Ythdc2	UTSW	18	44850424	missense	probably benign	0.05
R8114:Ythdc2	UTSW	18	44877740	missense	probably benign	0.15
R8820:Ythdc2	UTSW	18	44834464	nonsense	probably null
R8840:Ythdc2	UTSW	18	44860624	missense	probably damaging	1.00
R8998:Ythdc2	UTSW	18	44864304	missense	probably benign	0.31
R9065:Ythdc2	UTSW	18	44844351	missense	probably benign	0.00
R9196:Ythdc2	UTSW	18	44855397	missense	probably damaging	0.96
R9251:Ythdc2	UTSW	18	44841375	missense	probably benign	0.00
R9331:Ythdc2	UTSW	18	44837432	missense	possibly damaging	0.87
R9469:Ythdc2	UTSW	18	44886316	missense	probably damaging	1.00
R9634:Ythdc2	UTSW	18	44872970	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GGCTTGTTCAGTGCTGAGAC -3'
(R):5'- TTGTGTTGCATCCTTTGACAGAAG -3'

Sequencing Primer
(F):5'- CAGTGCTGAGACATATTGTTGTC -3'
(R):5'- GTTGCATCCTTTGACAGAAGAAAAAC -3'

Posted On

2016-05-10