Incidental Mutation 'R4982:Chsy3'
ID 384957
Institutional Source Beutler Lab
Gene Symbol Chsy3
Ensembl Gene ENSMUSG00000058152
Gene Name chondroitin sulfate synthase 3
Synonyms 4833446K15Rik
Accession Numbers

Ncbi RefSeq: NM_001081328.1; MGI:1926173

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 59175401-59410446 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 59409575 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 595 (S595L)
Ref Sequence ENSEMBL: ENSMUSP00000079546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080721]
AlphaFold Q5DTK1
Predicted Effect probably benign
Transcript: ENSMUST00000080721
AA Change: S595L

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000079546
Gene: ENSMUSG00000058152
AA Change: S595L

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 84 96 N/A INTRINSIC
low complexity region 125 144 N/A INTRINSIC
Pfam:Fringe 169 410 9.4e-19 PFAM
Pfam:CHGN 330 866 1.4e-194 PFAM
Pfam:Glyco_tranf_2_2 652 841 1.8e-7 PFAM
Pfam:Glyco_transf_7C 769 839 3.2e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSS3 is a glycosyltransferase that has both glucuronyltransferase and N-acetylgalactosaminyltransferase activities (Yada et al., 2003 [PubMed 12907687]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,292,348 I1404L possibly damaging Het
Adra1b A G 11: 43,835,230 S287P probably damaging Het
Atxn2 G T 5: 121,814,343 A1280S possibly damaging Het
Bbip1 T C 19: 53,932,208 probably null Het
Bbs2 A G 8: 94,082,354 probably null Het
Bcl11b A T 12: 107,965,772 C180* probably null Het
Bod1l A G 5: 41,820,473 V1166A probably benign Het
Bora C T 14: 99,047,352 P13S probably damaging Het
C2cd4c T C 10: 79,613,241 E24G probably benign Het
Ccne1 A T 7: 38,100,571 I196N probably damaging Het
Cntrob T A 11: 69,311,362 probably null Het
Col5a2 G A 1: 45,389,458 P983S possibly damaging Het
Crat T A 2: 30,407,136 probably null Het
Ctnnbl1 C T 2: 157,836,553 H359Y probably benign Het
D430041D05Rik A G 2: 104,255,387 V83A possibly damaging Het
Dixdc1 A G 9: 50,682,602 S488P possibly damaging Het
Dmrta1 T C 4: 89,688,564 C86R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Homo
Fam171a1 G A 2: 3,178,468 probably null Het
Fam222b T C 11: 78,154,743 C249R probably damaging Het
Fbxw18 T A 9: 109,702,651 probably benign Het
Fes T C 7: 80,387,204 Y44C probably damaging Het
Gimap6 A G 6: 48,707,999 V51A probably benign Het
Gpr75 C A 11: 30,891,462 H122Q probably damaging Het
Gpr75 C T 11: 30,891,463 L123F possibly damaging Het
Greb1 A G 12: 16,724,761 S212P probably damaging Het
Grin3a T C 4: 49,665,512 H1041R probably benign Het
Ifna5 A G 4: 88,835,624 N34D probably damaging Het
Ift140 A T 17: 25,036,994 H221L probably damaging Het
Igsf3 T C 3: 101,435,667 V540A probably benign Het
Il10ra A G 9: 45,269,059 L5S probably damaging Het
Klra2 A T 6: 131,220,189 D282E probably benign Het
Lyst T A 13: 13,725,954 H3138Q probably damaging Het
Malrd1 A G 2: 16,042,129 T1689A probably benign Het
Mon2 A T 10: 122,995,789 L1671M probably damaging Het
Mpped1 T C 15: 83,836,327 F71S probably damaging Het
Mtpap C A 18: 4,396,332 H541Q probably benign Het
Muc5ac T A 7: 141,809,456 probably benign Het
Mybbp1a T C 11: 72,445,214 I451T probably damaging Het
Myh7 T A 14: 54,972,767 E1827V probably damaging Het
Olfr132 A T 17: 38,130,577 I205N probably damaging Het
Olfr145 C A 9: 37,897,515 T37N probably damaging Het
Olfr342 A T 2: 36,527,397 probably null Het
Olfr501-ps1 T A 7: 108,508,648 Y197* probably null Het
Os9 C T 10: 127,121,051 R23H possibly damaging Het
Otud6b A G 4: 14,815,607 L261P probably damaging Het
Pcdhga2 A G 18: 37,669,423 N107D probably benign Het
Pclo C T 5: 14,679,294 probably benign Het
Peg10 T TCCG 6: 4,756,451 probably benign Het
Phtf1 T A 3: 103,998,708 S524T probably damaging Het
Pkdrej A C 15: 85,818,996 L913R probably damaging Het
Pld1 C A 3: 28,031,298 A201D probably damaging Het
Rorb T A 19: 18,977,688 Q103L probably benign Het
Sec24d C T 3: 123,299,606 T284M probably benign Het
Serpinb3b T C 1: 107,157,754 I86V probably benign Het
Serpinb6a A T 13: 33,918,874 M201K probably damaging Het
Snx8 A G 5: 140,352,234 S219P probably benign Het
Sp8 C T 12: 118,848,425 T5I probably damaging Het
Tanc1 A G 2: 59,799,943 N749D probably damaging Het
Tarm1 G C 7: 3,489,096 P284A probably damaging Het
Tbx15 A T 3: 99,254,074 E65V probably benign Het
Ticam1 T A 17: 56,272,020 H25L probably benign Het
Tmprss11g T A 5: 86,492,815 L170F probably damaging Het
Tnfsf9 A G 17: 57,107,504 *310W probably null Het
Tsks C T 7: 44,943,994 T128I possibly damaging Het
Uhrf1bp1 T C 17: 27,886,606 F702S probably benign Het
Vmn1r175 A T 7: 23,809,069 N44K possibly damaging Het
Vmn1r45 A G 6: 89,933,865 I41T probably damaging Het
Ythdc2 A G 18: 44,871,465 N1102S probably benign Het
Zswim4 C T 8: 84,226,667 probably null Het
Other mutations in Chsy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Chsy3 APN 18 59176367 missense probably damaging 1.00
IGL01543:Chsy3 APN 18 59410400 nonsense probably null
IGL01627:Chsy3 APN 18 59176295 missense probably damaging 1.00
IGL02232:Chsy3 APN 18 59409311 missense possibly damaging 0.89
IGL02604:Chsy3 APN 18 59409115 missense probably benign 0.00
IGL02888:Chsy3 APN 18 59409995 missense probably benign 0.00
IGL03199:Chsy3 APN 18 59176401 missense probably damaging 1.00
bajo UTSW 18 59176166 frame shift probably null
bajo2 UTSW 18 59176419 missense probably damaging 1.00
inferior UTSW 18 59176415 missense probably damaging 1.00
P0045:Chsy3 UTSW 18 59409006 nonsense probably null
R0456:Chsy3 UTSW 18 59176478 missense probably damaging 1.00
R0605:Chsy3 UTSW 18 59409053 missense probably damaging 0.97
R1068:Chsy3 UTSW 18 59410289 missense probably damaging 1.00
R1479:Chsy3 UTSW 18 59408913 missense probably benign 0.09
R1654:Chsy3 UTSW 18 59176416 missense probably damaging 1.00
R1868:Chsy3 UTSW 18 59176488 splice site probably null
R1938:Chsy3 UTSW 18 59409512 missense probably damaging 1.00
R2114:Chsy3 UTSW 18 59179489 missense probably damaging 1.00
R2146:Chsy3 UTSW 18 59176472 missense probably benign 0.04
R3693:Chsy3 UTSW 18 59176008 missense possibly damaging 0.88
R3787:Chsy3 UTSW 18 59408998 missense probably damaging 1.00
R3811:Chsy3 UTSW 18 59176170 missense probably benign 0.42
R3878:Chsy3 UTSW 18 59409773 missense probably damaging 1.00
R4385:Chsy3 UTSW 18 59176352 missense probably benign 0.00
R4385:Chsy3 UTSW 18 59179474 missense possibly damaging 0.95
R4512:Chsy3 UTSW 18 59410187 missense probably damaging 1.00
R4734:Chsy3 UTSW 18 59179413 missense probably benign 0.07
R4751:Chsy3 UTSW 18 59175800 missense possibly damaging 0.66
R4982:Chsy3 UTSW 18 59409767 missense possibly damaging 0.78
R5032:Chsy3 UTSW 18 59179471 missense probably damaging 1.00
R5088:Chsy3 UTSW 18 59179535 missense probably damaging 1.00
R5220:Chsy3 UTSW 18 59410030 missense probably damaging 0.99
R5257:Chsy3 UTSW 18 59409794 missense possibly damaging 0.50
R5259:Chsy3 UTSW 18 59410246 missense probably damaging 0.96
R5558:Chsy3 UTSW 18 59176397 missense probably damaging 1.00
R5872:Chsy3 UTSW 18 59176196 missense probably damaging 1.00
R5990:Chsy3 UTSW 18 59176166 frame shift probably null
R5992:Chsy3 UTSW 18 59176166 frame shift probably null
R6064:Chsy3 UTSW 18 59176166 frame shift probably null
R6065:Chsy3 UTSW 18 59176166 frame shift probably null
R6182:Chsy3 UTSW 18 59179342 missense probably benign 0.00
R6881:Chsy3 UTSW 18 59179408 missense probably damaging 1.00
R6985:Chsy3 UTSW 18 59176488 splice site probably null
R7046:Chsy3 UTSW 18 59409803 missense probably benign 0.00
R7078:Chsy3 UTSW 18 59176077 missense possibly damaging 0.51
R7105:Chsy3 UTSW 18 59176419 missense probably damaging 1.00
R7129:Chsy3 UTSW 18 59410298 missense probably damaging 1.00
R7151:Chsy3 UTSW 18 59409285 missense possibly damaging 0.55
R7224:Chsy3 UTSW 18 59408975 missense probably damaging 1.00
R7860:Chsy3 UTSW 18 59409227 missense probably benign 0.10
R7936:Chsy3 UTSW 18 59409346 missense probably damaging 1.00
R8010:Chsy3 UTSW 18 59410154 missense probably damaging 1.00
R8029:Chsy3 UTSW 18 59179447 missense possibly damaging 0.87
R8215:Chsy3 UTSW 18 59175869 nonsense probably null
R8332:Chsy3 UTSW 18 59409015 missense probably damaging 0.98
R8375:Chsy3 UTSW 18 59179513 missense probably damaging 1.00
R8560:Chsy3 UTSW 18 59410058 missense possibly damaging 0.91
R8700:Chsy3 UTSW 18 59176415 missense probably damaging 1.00
R9040:Chsy3 UTSW 18 59409688 missense probably damaging 0.98
R9290:Chsy3 UTSW 18 59409856 missense probably benign 0.00
R9413:Chsy3 UTSW 18 59176098 missense possibly damaging 0.66
R9490:Chsy3 UTSW 18 59179414 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACATATTGGACCTGCTACTC -3'
(R):5'- TTGATGGACTCTTGGCCAGC -3'

Sequencing Primer
(F):5'- TTGGACCTGCTACTCCTGTACAAAAG -3'
(R):5'- CATCCCTGCTGAAAAGGATGATGAC -3'
Posted On 2016-05-10