Incidental Mutation 'R0374:Aqr'
ID 38496
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Name aquarius
Synonyms
MMRRC Submission 038580-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0374 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 113931642-114005788 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 113961092 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 723 (H723Y)
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
AlphaFold Q8CFQ3
Predicted Effect probably damaging
Transcript: ENSMUST00000043160
AA Change: H723Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: H723Y

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102543
AA Change: H723Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: H723Y

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126701
Meta Mutation Damage Score 0.6516 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 99% (69/70)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano9 A G 7: 140,687,727 (GRCm39) I267T probably damaging Het
Anxa6 T A 11: 54,896,654 (GRCm39) N168I probably benign Het
Apbb1ip A G 2: 22,709,717 (GRCm39) probably benign Het
Bbx C T 16: 50,100,755 (GRCm39) E47K probably benign Het
Car13 A G 3: 14,721,357 (GRCm39) probably benign Het
Casp9 T A 4: 141,534,484 (GRCm39) I298N possibly damaging Het
Ccdc66 T C 14: 27,220,430 (GRCm39) E261G probably damaging Het
Cep192 T A 18: 67,951,954 (GRCm39) Y376* probably null Het
Cped1 T A 6: 22,222,545 (GRCm39) probably benign Het
Ctbp2 A T 7: 132,601,073 (GRCm39) S563R possibly damaging Het
Ctdp1 A G 18: 80,490,637 (GRCm39) probably null Het
Dgka G C 10: 128,556,952 (GRCm39) probably benign Het
Drd2 A G 9: 49,311,084 (GRCm39) T112A probably benign Het
Dusp1 A G 17: 26,727,143 (GRCm39) V52A probably damaging Het
Eea1 T A 10: 95,875,634 (GRCm39) probably benign Het
Etfrf1 T C 6: 145,161,288 (GRCm39) V86A probably benign Het
Fbn1 A T 2: 125,163,596 (GRCm39) C2087S possibly damaging Het
Fosb T G 7: 19,041,075 (GRCm39) R139S probably damaging Het
Foxm1 C T 6: 128,349,566 (GRCm39) R362W probably damaging Het
Frem2 A G 3: 53,561,381 (GRCm39) V1042A probably damaging Het
Gbe1 A G 16: 70,280,802 (GRCm39) H401R probably benign Het
Gm10549 C T 18: 33,597,235 (GRCm39) probably benign Het
Golga7b A T 19: 42,251,758 (GRCm39) probably benign Het
H2-DMb1 T C 17: 34,378,399 (GRCm39) V235A probably benign Het
Hr A G 14: 70,793,916 (GRCm39) T59A probably benign Het
Itpr2 C A 6: 146,260,890 (GRCm39) A588S probably benign Het
Kmt2c G A 5: 25,514,706 (GRCm39) P3046S probably damaging Het
Lamc1 G A 1: 153,126,811 (GRCm39) probably benign Het
Lrp2 A G 2: 69,260,651 (GRCm39) Y4527H probably damaging Het
Map3k2 G A 18: 32,345,226 (GRCm39) probably null Het
Mroh2a C A 1: 88,170,142 (GRCm39) A685D possibly damaging Het
Nfs1 C G 2: 155,974,580 (GRCm39) G212R probably damaging Het
Nol8 C T 13: 49,815,923 (GRCm39) A677V possibly damaging Het
Nrap T A 19: 56,340,054 (GRCm39) Y740F probably damaging Het
Nup205 T A 6: 35,185,772 (GRCm39) M859K probably damaging Het
Nxf1 T C 19: 8,745,103 (GRCm39) F451S possibly damaging Het
Or5an1c A T 19: 12,218,505 (GRCm39) N173K probably damaging Het
Or6c6c G A 10: 129,541,516 (GRCm39) M256I probably benign Het
Pcdhac2 T C 18: 37,278,720 (GRCm39) Y567H probably damaging Het
Phlpp2 C T 8: 110,634,145 (GRCm39) R242W probably damaging Het
Pi4ka A G 16: 17,100,796 (GRCm39) probably benign Het
Pmpcb A G 5: 21,953,829 (GRCm39) D359G probably damaging Het
Poll T G 19: 45,546,309 (GRCm39) S244R probably benign Het
Prkd3 T C 17: 79,264,644 (GRCm39) D657G probably null Het
Prune2 G A 19: 17,098,274 (GRCm39) M1259I probably benign Het
Ptpra T A 2: 130,379,541 (GRCm39) M329K probably damaging Het
Rbm10 GGGAGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG GGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG X: 20,503,798 (GRCm39) probably benign Het
Rbm15 G T 3: 107,237,880 (GRCm39) D839E probably damaging Het
Sap30bp T A 11: 115,855,103 (GRCm39) I271N probably damaging Het
Scart2 T A 7: 139,828,874 (GRCm39) C178S probably damaging Het
Scn3a A T 2: 65,338,918 (GRCm39) V587E probably damaging Het
Setdb1 A T 3: 95,232,164 (GRCm39) probably benign Het
Sgk3 T A 1: 9,949,306 (GRCm39) probably null Het
Shox2 A T 3: 66,881,184 (GRCm39) H265Q probably damaging Het
Slc9a2 T C 1: 40,783,017 (GRCm39) F427S possibly damaging Het
Smarca5 T A 8: 81,463,360 (GRCm39) Q69H probably benign Het
Specc1l T A 10: 75,084,293 (GRCm39) F672Y probably damaging Het
Ssh2 T A 11: 77,298,969 (GRCm39) S105R probably damaging Het
Syne2 C T 12: 75,968,000 (GRCm39) R917* probably null Het
Tbc1d2 G A 4: 46,649,913 (GRCm39) T41M possibly damaging Het
Tbx18 T A 9: 87,606,408 (GRCm39) I246F probably damaging Het
Tcf4 T A 18: 69,814,883 (GRCm39) probably benign Het
Tmed2 C A 5: 124,679,502 (GRCm39) probably null Het
Tmem243 A T 5: 9,151,361 (GRCm39) D15V possibly damaging Het
Vmn2r87 T A 10: 130,307,848 (GRCm39) S797C probably damaging Het
Vps13c T A 9: 67,793,528 (GRCm39) probably benign Het
Wls T A 3: 159,603,074 (GRCm39) C162* probably null Het
Zbtb7c C T 18: 76,270,464 (GRCm39) T184I probably benign Het
Zc3h13 A G 14: 75,546,405 (GRCm39) K169E probably damaging Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 113,956,423 (GRCm39) missense possibly damaging 0.90
IGL00694:Aqr APN 2 113,982,006 (GRCm39) missense probably damaging 1.00
IGL02113:Aqr APN 2 113,950,508 (GRCm39) nonsense probably null
IGL02297:Aqr APN 2 113,980,962 (GRCm39) missense probably benign 0.24
IGL02380:Aqr APN 2 113,940,417 (GRCm39) missense probably damaging 1.00
IGL02410:Aqr APN 2 113,967,398 (GRCm39) missense possibly damaging 0.85
IGL02413:Aqr APN 2 113,949,261 (GRCm39) missense possibly damaging 0.87
IGL02474:Aqr APN 2 113,943,127 (GRCm39) missense probably damaging 1.00
IGL02941:Aqr APN 2 113,943,835 (GRCm39) missense probably damaging 1.00
IGL02981:Aqr APN 2 113,965,305 (GRCm39) splice site probably benign
IGL03001:Aqr APN 2 113,977,400 (GRCm39) missense probably benign
IGL03092:Aqr APN 2 113,989,424 (GRCm39) missense probably benign 0.38
IGL03222:Aqr APN 2 113,951,737 (GRCm39) missense probably damaging 1.00
capricorn UTSW 2 113,936,363 (GRCm39) missense probably damaging 1.00
Goat UTSW 2 113,988,056 (GRCm39) missense probably damaging 1.00
Pliades UTSW 2 113,963,457 (GRCm39) missense probably damaging 1.00
sagittarius UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
Zodiac UTSW 2 113,938,590 (GRCm39) missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 113,961,215 (GRCm39) missense possibly damaging 0.94
R0103:Aqr UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
R0103:Aqr UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
R0152:Aqr UTSW 2 113,989,491 (GRCm39) missense probably benign 0.07
R0352:Aqr UTSW 2 114,000,533 (GRCm39) missense probably damaging 1.00
R0371:Aqr UTSW 2 113,988,085 (GRCm39) missense possibly damaging 0.80
R0550:Aqr UTSW 2 113,963,457 (GRCm39) missense probably damaging 1.00
R0604:Aqr UTSW 2 113,961,085 (GRCm39) missense probably benign 0.00
R0685:Aqr UTSW 2 113,971,458 (GRCm39) missense probably damaging 1.00
R1236:Aqr UTSW 2 113,947,136 (GRCm39) missense probably damaging 1.00
R1434:Aqr UTSW 2 113,980,890 (GRCm39) missense probably damaging 1.00
R1806:Aqr UTSW 2 113,992,133 (GRCm39) missense probably damaging 1.00
R2154:Aqr UTSW 2 113,967,485 (GRCm39) missense probably damaging 1.00
R2185:Aqr UTSW 2 113,961,015 (GRCm39) critical splice donor site probably null
R2377:Aqr UTSW 2 113,971,421 (GRCm39) missense possibly damaging 0.58
R2862:Aqr UTSW 2 113,967,398 (GRCm39) missense probably damaging 1.00
R3615:Aqr UTSW 2 113,967,368 (GRCm39) missense probably damaging 1.00
R3616:Aqr UTSW 2 113,967,368 (GRCm39) missense probably damaging 1.00
R3713:Aqr UTSW 2 113,949,150 (GRCm39) splice site probably benign
R3715:Aqr UTSW 2 113,949,150 (GRCm39) splice site probably benign
R4586:Aqr UTSW 2 113,943,058 (GRCm39) missense probably benign 0.06
R4663:Aqr UTSW 2 113,992,147 (GRCm39) nonsense probably null
R4809:Aqr UTSW 2 114,005,695 (GRCm39) utr 5 prime probably benign
R4887:Aqr UTSW 2 113,980,990 (GRCm39) missense probably damaging 1.00
R4888:Aqr UTSW 2 113,980,990 (GRCm39) missense probably damaging 1.00
R4952:Aqr UTSW 2 113,940,418 (GRCm39) missense probably damaging 1.00
R4974:Aqr UTSW 2 113,943,832 (GRCm39) missense probably damaging 1.00
R5050:Aqr UTSW 2 114,000,506 (GRCm39) critical splice donor site probably null
R5050:Aqr UTSW 2 113,943,090 (GRCm39) nonsense probably null
R5213:Aqr UTSW 2 113,943,808 (GRCm39) missense probably damaging 1.00
R5263:Aqr UTSW 2 113,947,059 (GRCm39) missense probably damaging 1.00
R5470:Aqr UTSW 2 113,988,056 (GRCm39) missense probably damaging 1.00
R5488:Aqr UTSW 2 113,963,554 (GRCm39) missense probably damaging 1.00
R5489:Aqr UTSW 2 113,963,554 (GRCm39) missense probably damaging 1.00
R5567:Aqr UTSW 2 113,979,451 (GRCm39) missense probably damaging 1.00
R5570:Aqr UTSW 2 113,979,451 (GRCm39) missense probably damaging 1.00
R5641:Aqr UTSW 2 113,979,515 (GRCm39) missense probably damaging 1.00
R5685:Aqr UTSW 2 113,986,746 (GRCm39) missense possibly damaging 0.87
R5963:Aqr UTSW 2 113,957,442 (GRCm39) missense probably damaging 1.00
R5992:Aqr UTSW 2 113,973,530 (GRCm39) nonsense probably null
R6015:Aqr UTSW 2 114,005,646 (GRCm39) start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 113,986,758 (GRCm39) missense possibly damaging 0.93
R6264:Aqr UTSW 2 113,940,445 (GRCm39) missense probably damaging 1.00
R6773:Aqr UTSW 2 113,979,477 (GRCm39) missense possibly damaging 0.64
R6877:Aqr UTSW 2 113,947,052 (GRCm39) nonsense probably null
R7211:Aqr UTSW 2 113,965,204 (GRCm39) missense probably benign 0.01
R7232:Aqr UTSW 2 113,936,363 (GRCm39) missense probably damaging 1.00
R7308:Aqr UTSW 2 113,934,543 (GRCm39) missense possibly damaging 0.86
R7396:Aqr UTSW 2 113,950,427 (GRCm39) nonsense probably null
R7490:Aqr UTSW 2 113,989,349 (GRCm39) critical splice donor site probably null
R7526:Aqr UTSW 2 113,938,590 (GRCm39) missense probably damaging 0.96
R7629:Aqr UTSW 2 113,945,074 (GRCm39) missense probably damaging 1.00
R7828:Aqr UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
R8037:Aqr UTSW 2 113,992,161 (GRCm39) missense probably damaging 1.00
R8166:Aqr UTSW 2 113,943,806 (GRCm39) missense possibly damaging 0.95
R8712:Aqr UTSW 2 113,949,358 (GRCm39) missense probably damaging 1.00
R8904:Aqr UTSW 2 113,967,474 (GRCm39) missense probably damaging 0.98
R9487:Aqr UTSW 2 113,934,528 (GRCm39) missense probably benign 0.04
R9527:Aqr UTSW 2 113,932,037 (GRCm39) missense probably benign 0.02
R9664:Aqr UTSW 2 113,971,396 (GRCm39) nonsense probably null
Z1176:Aqr UTSW 2 113,940,472 (GRCm39) missense probably benign 0.25
Z1176:Aqr UTSW 2 113,938,603 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGACTGCCAAAATGAAGTCCAGAC -3'
(R):5'- TGTTCAATAGGAGTCAAGCGGCAAG -3'

Sequencing Primer
(F):5'- CACAATGCTTAAAACTCACTTAGTC -3'
(R):5'- GCAGAAAGTAGCTTCTTGCC -3'
Posted On 2013-05-23