Incidental Mutation 'R4982:Rorb'
ID 384960
Institutional Source Beutler Lab
Gene Symbol Rorb
Ensembl Gene ENSMUSG00000036192
Gene Name RAR-related orphan receptor beta
Synonyms hstp, Rorbeta, RZR-beta, Nr1f2
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 18907969-19088560 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 18955052 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 103 (Q103L)
Ref Sequence ENSEMBL: ENSMUSP00000108447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040153] [ENSMUST00000112828] [ENSMUST00000112832]
AlphaFold Q8R1B8
Predicted Effect probably benign
Transcript: ENSMUST00000040153
AA Change: Q188L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000047597
Gene: ENSMUSG00000036192
AA Change: Q188L

DomainStartEndE-ValueType
ZnF_C4 18 89 1.51e-39 SMART
coiled coil region 95 133 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
HOLI 275 431 1.83e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112828
AA Change: Q103L

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000108447
Gene: ENSMUSG00000036192
AA Change: Q103L

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 49 60 N/A INTRINSIC
HOLI 190 346 1.83e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112832
AA Change: Q177L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108451
Gene: ENSMUSG00000036192
AA Change: Q177L

DomainStartEndE-ValueType
ZnF_C4 7 78 1.51e-39 SMART
coiled coil region 84 122 N/A INTRINSIC
low complexity region 123 134 N/A INTRINSIC
HOLI 264 420 1.83e-29 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147907
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149635
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the NR1 subfamily of nuclear hormone receptors. It is a DNA-binding protein that can bind as a monomer or as a homodimer to hormone response elements upstream of several genes to enhance the expression of those genes. The encoded protein has been shown to interact with NM23-2, a nucleoside diphosphate kinase involved in organogenesis and differentiation, and to help regulate the expression of some genes involved in circadian rhythm. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene have impaired vision and a variety of behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,348 (GRCm39) I1404L possibly damaging Het
Adra1b A G 11: 43,726,057 (GRCm39) S287P probably damaging Het
Atxn2 G T 5: 121,952,406 (GRCm39) A1280S possibly damaging Het
Bbip1 T C 19: 53,920,639 (GRCm39) probably null Het
Bbs2 A G 8: 94,808,982 (GRCm39) probably null Het
Bcl11b A T 12: 107,932,031 (GRCm39) C180* probably null Het
Bltp3a T C 17: 28,105,580 (GRCm39) F702S probably benign Het
Bod1l A G 5: 41,977,816 (GRCm39) V1166A probably benign Het
Bora C T 14: 99,284,788 (GRCm39) P13S probably damaging Het
C2cd4c T C 10: 79,449,075 (GRCm39) E24G probably benign Het
Ccne1 A T 7: 37,799,996 (GRCm39) I196N probably damaging Het
Chsy3 C T 18: 59,542,647 (GRCm39) S595L probably benign Het
Chsy3 T A 18: 59,542,839 (GRCm39) I659N possibly damaging Het
Cntrob T A 11: 69,202,188 (GRCm39) probably null Het
Col5a2 G A 1: 45,428,618 (GRCm39) P983S possibly damaging Het
Crat T A 2: 30,297,148 (GRCm39) probably null Het
Ctnnbl1 C T 2: 157,678,473 (GRCm39) H359Y probably benign Het
D430041D05Rik A G 2: 104,085,732 (GRCm39) V83A possibly damaging Het
Dixdc1 A G 9: 50,593,902 (GRCm39) S488P possibly damaging Het
Dmrta1 T C 4: 89,576,801 (GRCm39) C86R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Fam171a1 G A 2: 3,179,505 (GRCm39) probably null Het
Fam222b T C 11: 78,045,569 (GRCm39) C249R probably damaging Het
Fbxw18 T A 9: 109,531,719 (GRCm39) probably benign Het
Fes T C 7: 80,036,952 (GRCm39) Y44C probably damaging Het
Gimap6 A G 6: 48,684,933 (GRCm39) V51A probably benign Het
Gpr75 C T 11: 30,841,463 (GRCm39) L123F possibly damaging Het
Gpr75 C A 11: 30,841,462 (GRCm39) H122Q probably damaging Het
Greb1 A G 12: 16,774,762 (GRCm39) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm39) H1041R probably benign Het
Ifna5 A G 4: 88,753,861 (GRCm39) N34D probably damaging Het
Ift140 A T 17: 25,255,968 (GRCm39) H221L probably damaging Het
Igsf3 T C 3: 101,342,983 (GRCm39) V540A probably benign Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Klra2 A T 6: 131,197,152 (GRCm39) D282E probably benign Het
Lyst T A 13: 13,900,539 (GRCm39) H3138Q probably damaging Het
Malrd1 A G 2: 16,046,940 (GRCm39) T1689A probably benign Het
Mon2 A T 10: 122,831,694 (GRCm39) L1671M probably damaging Het
Mpped1 T C 15: 83,720,528 (GRCm39) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm39) H541Q probably benign Het
Muc5ac T A 7: 141,363,193 (GRCm39) probably benign Het
Mybbp1a T C 11: 72,336,040 (GRCm39) I451T probably damaging Het
Myh7 T A 14: 55,210,224 (GRCm39) E1827V probably damaging Het
Or1j14 A T 2: 36,417,409 (GRCm39) probably null Het
Or2h15 A T 17: 38,441,468 (GRCm39) I205N probably damaging Het
Or5p75-ps1 T A 7: 108,107,855 (GRCm39) Y197* probably null Het
Or8b8 C A 9: 37,808,811 (GRCm39) T37N probably damaging Het
Os9 C T 10: 126,956,920 (GRCm39) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm39) L261P probably damaging Het
Pcdhga2 A G 18: 37,802,476 (GRCm39) N107D probably benign Het
Pclo C T 5: 14,729,308 (GRCm39) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phtf1 T A 3: 103,906,024 (GRCm39) S524T probably damaging Het
Pkdrej A C 15: 85,703,197 (GRCm39) L913R probably damaging Het
Pld1 C A 3: 28,085,447 (GRCm39) A201D probably damaging Het
Sec24d C T 3: 123,093,255 (GRCm39) T284M probably benign Het
Serpinb3b T C 1: 107,085,484 (GRCm39) I86V probably benign Het
Serpinb6a A T 13: 34,102,857 (GRCm39) M201K probably damaging Het
Snx8 A G 5: 140,337,989 (GRCm39) S219P probably benign Het
Sp8 C T 12: 118,812,160 (GRCm39) T5I probably damaging Het
Tanc1 A G 2: 59,630,287 (GRCm39) N749D probably damaging Het
Tarm1 G C 7: 3,537,612 (GRCm39) P284A probably damaging Het
Tbx15 A T 3: 99,161,390 (GRCm39) E65V probably benign Het
Ticam1 T A 17: 56,579,020 (GRCm39) H25L probably benign Het
Tmprss11g T A 5: 86,640,674 (GRCm39) L170F probably damaging Het
Tnfsf9 A G 17: 57,414,504 (GRCm39) *310W probably null Het
Tsks C T 7: 44,593,418 (GRCm39) T128I possibly damaging Het
Vmn1r175 A T 7: 23,508,494 (GRCm39) N44K possibly damaging Het
Vmn1r45 A G 6: 89,910,847 (GRCm39) I41T probably damaging Het
Ythdc2 A G 18: 45,004,532 (GRCm39) N1102S probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Rorb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rorb APN 19 18,934,692 (GRCm39) nonsense probably null
IGL01576:Rorb APN 19 18,934,698 (GRCm39) missense probably damaging 1.00
IGL02863:Rorb APN 19 18,929,617 (GRCm39) missense probably benign 0.05
IGL02886:Rorb APN 19 18,954,943 (GRCm39) critical splice donor site probably null
4-limb_clasper UTSW 19 18,960,715 (GRCm39) missense probably damaging 1.00
dee-no UTSW 19 18,932,417 (GRCm39) missense probably damaging 1.00
grasshopper UTSW 19 19,087,921 (GRCm39) start codon destroyed probably null 0.45
IGL02988:Rorb UTSW 19 18,915,336 (GRCm39) missense probably damaging 1.00
R0748:Rorb UTSW 19 18,955,164 (GRCm39) missense probably damaging 0.97
R1087:Rorb UTSW 19 18,937,778 (GRCm39) missense probably damaging 1.00
R1438:Rorb UTSW 19 18,932,417 (GRCm39) missense probably damaging 1.00
R1710:Rorb UTSW 19 18,937,865 (GRCm39) missense probably damaging 1.00
R1846:Rorb UTSW 19 18,932,445 (GRCm39) missense probably damaging 1.00
R1852:Rorb UTSW 19 18,939,447 (GRCm39) missense probably damaging 1.00
R1972:Rorb UTSW 19 18,929,567 (GRCm39) missense probably damaging 0.96
R3903:Rorb UTSW 19 18,939,463 (GRCm39) missense probably damaging 0.99
R3978:Rorb UTSW 19 18,915,254 (GRCm39) missense probably benign 0.00
R4497:Rorb UTSW 19 18,954,992 (GRCm39) missense possibly damaging 0.95
R5602:Rorb UTSW 19 18,955,301 (GRCm39) missense probably damaging 0.97
R5733:Rorb UTSW 19 18,965,471 (GRCm39) missense probably damaging 1.00
R6267:Rorb UTSW 19 18,955,221 (GRCm39) missense possibly damaging 0.88
R6455:Rorb UTSW 19 18,937,856 (GRCm39) missense probably damaging 1.00
R6544:Rorb UTSW 19 18,929,614 (GRCm39) missense possibly damaging 0.66
R6753:Rorb UTSW 19 18,934,611 (GRCm39) missense probably benign 0.02
R7817:Rorb UTSW 19 18,965,460 (GRCm39) missense probably damaging 1.00
R8708:Rorb UTSW 19 18,960,780 (GRCm39) missense probably damaging 1.00
R8918:Rorb UTSW 19 18,915,356 (GRCm39) missense probably damaging 1.00
R8974:Rorb UTSW 19 18,955,070 (GRCm39) missense probably benign 0.00
R9033:Rorb UTSW 19 18,965,422 (GRCm39) start gained probably benign
R9136:Rorb UTSW 19 18,934,686 (GRCm39) missense probably damaging 1.00
R9617:Rorb UTSW 19 18,939,499 (GRCm39) nonsense probably null
R9622:Rorb UTSW 19 18,955,115 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGTAGAAACCAGGTATGCATGC -3'
(R):5'- GGTGTACAGCAGCAGCATTAG -3'

Sequencing Primer
(F):5'- TCTAGGGCTGTGAAAAACGACTTCC -3'
(R):5'- GCAGCATTAGCAATGGCCTCAG -3'
Posted On 2016-05-10