Incidental Mutation 'R4982:Bbip1'
ID 384961
Institutional Source Beutler Lab
Gene Symbol Bbip1
Ensembl Gene ENSMUSG00000084957
Gene Name BBSome interacting protein 1
Synonyms 4930560M04Rik, Ncrna00081, 2610002B11Rik, 2310002J21Rik
Accession Numbers
Essential gene? Probably non essential (E-score: 0.097) question?
Stock # R4982 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 53918292-53933058 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 53920639 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025931] [ENSMUST00000074371] [ENSMUST00000135402] [ENSMUST00000165617]
AlphaFold J3QMK2
Predicted Effect probably benign
Transcript: ENSMUST00000025931
SMART Domains Protein: ENSMUSP00000025931
Gene: ENSMUSG00000024975

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074371
SMART Domains Protein: ENSMUSP00000073975
Gene: ENSMUSG00000024975

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Predicted Effect probably null
Transcript: ENSMUST00000135402
SMART Domains Protein: ENSMUSP00000136324
Gene: ENSMUSG00000084957

DomainStartEndE-ValueType
Pfam:BBIP10 1 64 2.7e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165617
SMART Domains Protein: ENSMUSP00000133135
Gene: ENSMUSG00000024975

DomainStartEndE-ValueType
low complexity region 66 82 N/A INTRINSIC
low complexity region 96 122 N/A INTRINSIC
MA3 164 275 3.68e-41 SMART
MA3 327 440 5.01e-43 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of eight proteins that form the BBSome complex and is essential for its assembly. The BBSome complex is involved in trafficking signal receptors to and from the cilia. Mutations in this gene result in Bardet-Biedl syndrome 18. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a null mutation display strain dependent postnatal lethality, obesity, hyperphagia, retinal degeneration and male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,242,348 (GRCm39) I1404L possibly damaging Het
Adra1b A G 11: 43,726,057 (GRCm39) S287P probably damaging Het
Atxn2 G T 5: 121,952,406 (GRCm39) A1280S possibly damaging Het
Bbs2 A G 8: 94,808,982 (GRCm39) probably null Het
Bcl11b A T 12: 107,932,031 (GRCm39) C180* probably null Het
Bltp3a T C 17: 28,105,580 (GRCm39) F702S probably benign Het
Bod1l A G 5: 41,977,816 (GRCm39) V1166A probably benign Het
Bora C T 14: 99,284,788 (GRCm39) P13S probably damaging Het
C2cd4c T C 10: 79,449,075 (GRCm39) E24G probably benign Het
Ccne1 A T 7: 37,799,996 (GRCm39) I196N probably damaging Het
Chsy3 C T 18: 59,542,647 (GRCm39) S595L probably benign Het
Chsy3 T A 18: 59,542,839 (GRCm39) I659N possibly damaging Het
Cntrob T A 11: 69,202,188 (GRCm39) probably null Het
Col5a2 G A 1: 45,428,618 (GRCm39) P983S possibly damaging Het
Crat T A 2: 30,297,148 (GRCm39) probably null Het
Ctnnbl1 C T 2: 157,678,473 (GRCm39) H359Y probably benign Het
D430041D05Rik A G 2: 104,085,732 (GRCm39) V83A possibly damaging Het
Dixdc1 A G 9: 50,593,902 (GRCm39) S488P possibly damaging Het
Dmrta1 T C 4: 89,576,801 (GRCm39) C86R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Homo
Fam171a1 G A 2: 3,179,505 (GRCm39) probably null Het
Fam222b T C 11: 78,045,569 (GRCm39) C249R probably damaging Het
Fbxw18 T A 9: 109,531,719 (GRCm39) probably benign Het
Fes T C 7: 80,036,952 (GRCm39) Y44C probably damaging Het
Gimap6 A G 6: 48,684,933 (GRCm39) V51A probably benign Het
Gpr75 C T 11: 30,841,463 (GRCm39) L123F possibly damaging Het
Gpr75 C A 11: 30,841,462 (GRCm39) H122Q probably damaging Het
Greb1 A G 12: 16,774,762 (GRCm39) S212P probably damaging Het
Grin3a T C 4: 49,665,512 (GRCm39) H1041R probably benign Het
Ifna5 A G 4: 88,753,861 (GRCm39) N34D probably damaging Het
Ift140 A T 17: 25,255,968 (GRCm39) H221L probably damaging Het
Igsf3 T C 3: 101,342,983 (GRCm39) V540A probably benign Het
Il10ra A G 9: 45,180,357 (GRCm39) L5S probably damaging Het
Klra2 A T 6: 131,197,152 (GRCm39) D282E probably benign Het
Lyst T A 13: 13,900,539 (GRCm39) H3138Q probably damaging Het
Malrd1 A G 2: 16,046,940 (GRCm39) T1689A probably benign Het
Mon2 A T 10: 122,831,694 (GRCm39) L1671M probably damaging Het
Mpped1 T C 15: 83,720,528 (GRCm39) F71S probably damaging Het
Mtpap C A 18: 4,396,332 (GRCm39) H541Q probably benign Het
Muc5ac T A 7: 141,363,193 (GRCm39) probably benign Het
Mybbp1a T C 11: 72,336,040 (GRCm39) I451T probably damaging Het
Myh7 T A 14: 55,210,224 (GRCm39) E1827V probably damaging Het
Or1j14 A T 2: 36,417,409 (GRCm39) probably null Het
Or2h15 A T 17: 38,441,468 (GRCm39) I205N probably damaging Het
Or5p75-ps1 T A 7: 108,107,855 (GRCm39) Y197* probably null Het
Or8b8 C A 9: 37,808,811 (GRCm39) T37N probably damaging Het
Os9 C T 10: 126,956,920 (GRCm39) R23H possibly damaging Het
Otud6b A G 4: 14,815,607 (GRCm39) L261P probably damaging Het
Pcdhga2 A G 18: 37,802,476 (GRCm39) N107D probably benign Het
Pclo C T 5: 14,729,308 (GRCm39) probably benign Het
Peg10 T TCCG 6: 4,756,451 (GRCm39) probably benign Het
Phtf1 T A 3: 103,906,024 (GRCm39) S524T probably damaging Het
Pkdrej A C 15: 85,703,197 (GRCm39) L913R probably damaging Het
Pld1 C A 3: 28,085,447 (GRCm39) A201D probably damaging Het
Rorb T A 19: 18,955,052 (GRCm39) Q103L probably benign Het
Sec24d C T 3: 123,093,255 (GRCm39) T284M probably benign Het
Serpinb3b T C 1: 107,085,484 (GRCm39) I86V probably benign Het
Serpinb6a A T 13: 34,102,857 (GRCm39) M201K probably damaging Het
Snx8 A G 5: 140,337,989 (GRCm39) S219P probably benign Het
Sp8 C T 12: 118,812,160 (GRCm39) T5I probably damaging Het
Tanc1 A G 2: 59,630,287 (GRCm39) N749D probably damaging Het
Tarm1 G C 7: 3,537,612 (GRCm39) P284A probably damaging Het
Tbx15 A T 3: 99,161,390 (GRCm39) E65V probably benign Het
Ticam1 T A 17: 56,579,020 (GRCm39) H25L probably benign Het
Tmprss11g T A 5: 86,640,674 (GRCm39) L170F probably damaging Het
Tnfsf9 A G 17: 57,414,504 (GRCm39) *310W probably null Het
Tsks C T 7: 44,593,418 (GRCm39) T128I possibly damaging Het
Vmn1r175 A T 7: 23,508,494 (GRCm39) N44K possibly damaging Het
Vmn1r45 A G 6: 89,910,847 (GRCm39) I41T probably damaging Het
Ythdc2 A G 18: 45,004,532 (GRCm39) N1102S probably benign Het
Zswim4 C T 8: 84,953,296 (GRCm39) probably null Het
Other mutations in Bbip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3741:Bbip1 UTSW 19 53,920,606 (GRCm39) start codon destroyed probably null 0.58
R4610:Bbip1 UTSW 19 53,920,606 (GRCm39) start codon destroyed probably null 0.58
R5248:Bbip1 UTSW 19 53,919,786 (GRCm39) unclassified probably benign
R6344:Bbip1 UTSW 19 53,919,912 (GRCm39) missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TACAGCTTCCTCATGAACAGTGAG -3'
(R):5'- GGGAAGCTAGAATGTTTGATATTCC -3'

Sequencing Primer
(F):5'- GCTTCCTCATGAACAGTGAGAGTAC -3'
(R):5'- CCGTGCAGATAATGTAGGA -3'
Posted On 2016-05-10