Mutagenetix > Incidental Mutation

Incidental Mutation 'R4982:Dnase1l1'

384962

Institutional Source

Beutler Lab

Gene Symbol

Dnase1l1

Ensembl Gene

ENSMUSG00000019088

Gene Name

deoxyribonuclease 1-like 1

Synonyms

Dnase1ll, G4.8, Dnl1ll, 2310005K03Rik

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R4982 (G1)

Quality Score

222

Status

Not validated

Chromosome

Chromosomal Location

74273217-74282337 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 74277038 bp (GRCm38)

Zygosity

Homozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113515 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008826] [ENSMUST00000019232] [ENSMUST00000074085] [ENSMUST00000075821] [ENSMUST00000114189] [ENSMUST00000119361] [ENSMUST00000135690] [ENSMUST00000151702]

AlphaFold

Q9D7J6

Predicted Effect

probably benign
Transcript: ENSMUST00000008826

SMART Domains

Protein: ENSMUSP00000008826
Gene: ENSMUSG00000008682

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L16	5	167	1.1e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000019232

SMART Domains

Protein: ENSMUSP00000019232
Gene: ENSMUSG00000019088

Domain	Start	End	E-Value	Type
DNaseIc	21	289	3.93e-149	SMART
low complexity region	301	313	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000074085

SMART Domains

Protein: ENSMUSP00000082055
Gene: ENSMUSG00000008682

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L16	5	167	1.1e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000075821

SMART Domains

Protein: ENSMUSP00000075218
Gene: ENSMUSG00000019088

Domain	Start	End	E-Value	Type
DNaseIc	21	289	3.93e-149	SMART
low complexity region	301	313	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083047

Predicted Effect

probably null
Transcript: ENSMUST00000114189

SMART Domains

Protein: ENSMUSP00000109827
Gene: ENSMUSG00000019088

Domain	Start	End	E-Value	Type
Blast:DNaseIc	21	70	5e-22	BLAST
SCOP:d2dnja_	39	79	2e-4	SMART
low complexity region	91	103	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000119361

SMART Domains

Protein: ENSMUSP00000113515
Gene: ENSMUSG00000019088

Domain	Start	End	E-Value	Type
Blast:DNaseIc	21	64	2e-22	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000121868

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125775

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128763

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134330

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135012

Predicted Effect

probably benign
Transcript: ENSMUST00000135690

SMART Domains

Protein: ENSMUSP00000119500
Gene: ENSMUSG00000008682

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L16	5	150	1.2e-20	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138954

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184075

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148882

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149171

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146260

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142142

Predicted Effect

probably benign
Transcript: ENSMUST00000151702

SMART Domains

Protein: ENSMUSP00000115919
Gene: ENSMUSG00000008682

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L16	5	167	1.5e-34	PFAM

Meta Mutation Damage Score

0.9711

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.6%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]
PHENOTYPE: Female mice homozygous for an inactivating mutation of this gene exhibit poor motor coordination on the rotarod even on days 4 and 5 of a 5-day test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	A	T	11: 9,292,348	I1404L	possibly damaging	Het
Adra1b	A	G	11: 43,835,230	S287P	probably damaging	Het
Atxn2	G	T	5: 121,814,343	A1280S	possibly damaging	Het
Bbip1	T	C	19: 53,932,208		probably null	Het
Bbs2	A	G	8: 94,082,354		probably null	Het
Bcl11b	A	T	12: 107,965,772	C180*	probably null	Het
Bod1l	A	G	5: 41,820,473	V1166A	probably benign	Het
Bora	C	T	14: 99,047,352	P13S	probably damaging	Het
C2cd4c	T	C	10: 79,613,241	E24G	probably benign	Het
Ccne1	A	T	7: 38,100,571	I196N	probably damaging	Het
Chsy3	C	T	18: 59,409,575	S595L	probably benign	Het
Chsy3	T	A	18: 59,409,767	I659N	possibly damaging	Het
Cntrob	T	A	11: 69,311,362		probably null	Het
Col5a2	G	A	1: 45,389,458	P983S	possibly damaging	Het
Crat	T	A	2: 30,407,136		probably null	Het
Ctnnbl1	C	T	2: 157,836,553	H359Y	probably benign	Het
D430041D05Rik	A	G	2: 104,255,387	V83A	possibly damaging	Het
Dixdc1	A	G	9: 50,682,602	S488P	possibly damaging	Het
Dmrta1	T	C	4: 89,688,564	C86R	probably damaging	Het
Fam171a1	G	A	2: 3,178,468		probably null	Het
Fam222b	T	C	11: 78,154,743	C249R	probably damaging	Het
Fbxw18	T	A	9: 109,702,651		probably benign	Het
Fes	T	C	7: 80,387,204	Y44C	probably damaging	Het
Gimap6	A	G	6: 48,707,999	V51A	probably benign	Het
Gpr75	C	A	11: 30,891,462	H122Q	probably damaging	Het
Gpr75	C	T	11: 30,891,463	L123F	possibly damaging	Het
Greb1	A	G	12: 16,724,761	S212P	probably damaging	Het
Grin3a	T	C	4: 49,665,512	H1041R	probably benign	Het
Ifna5	A	G	4: 88,835,624	N34D	probably damaging	Het
Ift140	A	T	17: 25,036,994	H221L	probably damaging	Het
Igsf3	T	C	3: 101,435,667	V540A	probably benign	Het
Il10ra	A	G	9: 45,269,059	L5S	probably damaging	Het
Klra2	A	T	6: 131,220,189	D282E	probably benign	Het
Lyst	T	A	13: 13,725,954	H3138Q	probably damaging	Het
Malrd1	A	G	2: 16,042,129	T1689A	probably benign	Het
Mon2	A	T	10: 122,995,789	L1671M	probably damaging	Het
Mpped1	T	C	15: 83,836,327	F71S	probably damaging	Het
Mtpap	C	A	18: 4,396,332	H541Q	probably benign	Het
Muc5ac	T	A	7: 141,809,456		probably benign	Het
Mybbp1a	T	C	11: 72,445,214	I451T	probably damaging	Het
Myh7	T	A	14: 54,972,767	E1827V	probably damaging	Het
Olfr132	A	T	17: 38,130,577	I205N	probably damaging	Het
Olfr145	C	A	9: 37,897,515	T37N	probably damaging	Het
Olfr342	A	T	2: 36,527,397		probably null	Het
Olfr501-ps1	T	A	7: 108,508,648	Y197*	probably null	Het
Os9	C	T	10: 127,121,051	R23H	possibly damaging	Het
Otud6b	A	G	4: 14,815,607	L261P	probably damaging	Het
Pcdhga2	A	G	18: 37,669,423	N107D	probably benign	Het
Pclo	C	T	5: 14,679,294		probably benign	Het
Peg10	T	TCCG	6: 4,756,451		probably benign	Het
Phtf1	T	A	3: 103,998,708	S524T	probably damaging	Het
Pkdrej	A	C	15: 85,818,996	L913R	probably damaging	Het
Pld1	C	A	3: 28,031,298	A201D	probably damaging	Het
Rorb	T	A	19: 18,977,688	Q103L	probably benign	Het
Sec24d	C	T	3: 123,299,606	T284M	probably benign	Het
Serpinb3b	T	C	1: 107,157,754	I86V	probably benign	Het
Serpinb6a	A	T	13: 33,918,874	M201K	probably damaging	Het
Snx8	A	G	5: 140,352,234	S219P	probably benign	Het
Sp8	C	T	12: 118,848,425	T5I	probably damaging	Het
Tanc1	A	G	2: 59,799,943	N749D	probably damaging	Het
Tarm1	G	C	7: 3,489,096	P284A	probably damaging	Het
Tbx15	A	T	3: 99,254,074	E65V	probably benign	Het
Ticam1	T	A	17: 56,272,020	H25L	probably benign	Het
Tmprss11g	T	A	5: 86,492,815	L170F	probably damaging	Het
Tnfsf9	A	G	17: 57,107,504	*310W	probably null	Het
Tsks	C	T	7: 44,943,994	T128I	possibly damaging	Het
Uhrf1bp1	T	C	17: 27,886,606	F702S	probably benign	Het
Vmn1r175	A	T	7: 23,809,069	N44K	possibly damaging	Het
Vmn1r45	A	G	6: 89,933,865	I41T	probably damaging	Het
Ythdc2	A	G	18: 44,871,465	N1102S	probably benign	Het
Zswim4	C	T	8: 84,226,667		probably null	Het

Other mutations in Dnase1l1

Allele	Source	Chr	Coord	Type	Predicted Effect
R4691:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4752:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4753:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4814:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4815:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4846:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4861:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4862:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4872:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4873:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4875:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4978:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4979:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4980:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4981:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4983:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5039:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5084:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5085:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5086:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5087:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5106:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5107:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5108:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5109:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5137:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5171:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5266:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5296:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5330:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5417:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5418:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5419:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5448:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5450:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5466:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5467:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6126:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6128:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6129:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6130:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6232:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6233:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6234:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6242:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6305:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6306:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6329:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6343:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6344:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6396:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6397:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6449:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6450:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6585:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6586:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6646:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6679:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6681:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6845:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6847:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R8526:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GATTGGTACCAGAGTGGCTG -3'
(R):5'- AACCTGGATTCCTTTGGAGGG -3'

Sequencing Primer
(F):5'- TACCAGAGTGGCTGCAGAC -3'
(R):5'- GGTTCCTGATGCACACATAGCAATG -3'

Posted On

2016-05-10