Mutagenetix > Incidental Mutations

Incidental Mutation 'R4993:Siglec1'

384974

Institutional Source

Beutler Lab

Gene Symbol

Siglec1

Ensembl Gene

ENSMUSG00000027322

Gene Name

sialic acid binding Ig-like lectin 1, sialoadhesin

Synonyms

Sn, CD169, Siglec-1

MMRRC Submission

042587-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.076) question?

Stock #

R4993 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

131069220-131086765 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 131073361 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1437 (I1437F)

Ref Sequence

ENSEMBL: ENSMUSP00000105856 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028794] [ENSMUST00000110227]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028794
AA Change: I1437F

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000028794
Gene: ENSMUSG00000027322
AA Change: I1437F

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IG	32	142	2.92e-5	SMART
Pfam:C2-set_2	148	235	9.4e-18	PFAM
IGc2	260	319	8.78e-9	SMART
IGc2	344	404	4.07e-4	SMART
IGc2	431	505	3.3e-4	SMART
IGc2	529	589	5.75e-4	SMART
IGc2	622	698	3.54e-4	SMART
low complexity region	700	705	N/A	INTRINSIC
IG	716	795	3.35e-5	SMART
IG	804	896	6.51e-3	SMART
IGc2	909	969	4.13e-5	SMART
IG_like	1001	1076	6.78e-2	SMART
low complexity region	1077	1088	N/A	INTRINSIC
IG	1094	1171	4.32e-8	SMART
IG_like	1185	1250	1.94e-2	SMART
IG	1268	1345	1.36e-5	SMART
IG_like	1354	1447	1.45e1	SMART
IG_like	1365	1435	4.51e-2	SMART
IG	1454	1534	4.56e-7	SMART
IG_like	1549	1624	1.21e-1	SMART
transmembrane domain	1647	1669	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110227
AA Change: I1437F

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105856
Gene: ENSMUSG00000027322
AA Change: I1437F

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IG	32	142	2.92e-5	SMART
Pfam:C2-set_2	148	235	7e-17	PFAM
IGc2	260	319	8.78e-9	SMART
IGc2	344	404	4.07e-4	SMART
IGc2	431	505	3.3e-4	SMART
IGc2	529	589	5.75e-4	SMART
IGc2	622	698	3.54e-4	SMART
low complexity region	700	705	N/A	INTRINSIC
IG	716	795	3.35e-5	SMART
IG	804	896	6.51e-3	SMART
IGc2	909	969	4.13e-5	SMART
IG_like	1001	1076	6.78e-2	SMART
low complexity region	1077	1088	N/A	INTRINSIC
IG	1094	1171	4.32e-8	SMART
IG_like	1185	1250	1.94e-2	SMART
IG	1268	1345	1.36e-5	SMART
IG_like	1354	1447	1.45e1	SMART
IG_like	1365	1435	4.51e-2	SMART
IG	1454	1534	4.56e-7	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin superfamily. The encoded protein is a lectin-like adhesion molecule that binds glycoconjugate ligands on cell surfaces in a sialic acid-dependent manner. It is a type I transmembrane protein expressed only by a subpopulation of macrophages and is involved in mediating cell-cell interactions. Alternative splicing produces a transcript variant encoding an isoform that is soluble rather than membrane-bound; however, the full-length nature of this variant has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a disruption in this gene display subtle changes in B- and T-cell populations and decreased IgM levels. Mice homozygous for a knock-out or knock-in allele exhibit impaired phagocytosis of sialylated C. jejuni. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
9130008F23Rik	G	T	17: 40,880,161	Q126K	probably benign	Het
Abca15	C	A	7: 120,401,718	N1492K	probably damaging	Het
Afap1l2	C	T	19: 56,918,040	D402N	probably damaging	Het
Akap11	A	G	14: 78,512,968	F660L	probably damaging	Het
Bcl3	T	C	7: 19,820,177	T89A	probably benign	Het
Bub1b	T	C	2: 118,636,770	I858T	possibly damaging	Het
Cdk19	A	G	10: 40,476,218	D288G	possibly damaging	Het
Cyp2d34	T	A	15: 82,618,329	D202V	probably damaging	Het
Dip2c	T	G	13: 9,575,223	Y584*	probably null	Het
Dpf3	A	T	12: 83,331,861		probably null	Het
Drp2	G	A	X: 134,441,316	R567H	probably damaging	Homo
Emid1	G	T	11: 5,131,512	Q212K	probably benign	Het
Esm1	C	T	13: 113,213,399	Q118*	probably null	Het
Fahd2a	T	G	2: 127,436,364	I308L	probably benign	Het
Fam208a	T	A	14: 27,429,114	W16R	possibly damaging	Het
Fanci	T	C	7: 79,435,378	*851Q	probably null	Het
Fastkd1	C	A	2: 69,702,740	V428F	probably damaging	Het
Fat2	A	T	11: 55,283,092	I2265N	probably damaging	Het
Gale	C	A	4: 135,966,860	H191Q	probably damaging	Het
Ghsr	T	A	3: 27,372,254	V153E	possibly damaging	Het
Gm10696	C	T	3: 94,176,316	G63R	probably damaging	Het
Gpc6	A	G	14: 117,624,539	N289S	possibly damaging	Het
Hoxb6	A	T	11: 96,300,711	Y153F	probably damaging	Het
Ints3	T	C	3: 90,415,507	T139A	probably benign	Het
Irf2bp2	A	G	8: 126,592,671	S256P	probably benign	Het
Klf4	G	T	4: 55,530,640	P148Q	probably damaging	Het
Loxl1	T	G	9: 58,312,537	H117P	probably damaging	Het
Lpl	A	G	8: 68,895,793	K225E	probably benign	Het
Lrba	T	A	3: 86,360,037	V1678D	probably damaging	Het
Med1	A	T	11: 98,163,904	F398Y	probably damaging	Het
Mfap2	T	C	4: 141,015,578	*186Q	probably null	Het
Mfsd3	T	C	15: 76,701,982	L105P	probably damaging	Het
Mlxip	T	G	5: 123,395,294	I122S	probably damaging	Het
Mmrn2	A	T	14: 34,396,398	Y107F	probably damaging	Het
Mtg1	G	T	7: 140,140,283	D88Y	probably null	Het
Mutyh	T	A	4: 116,817,935	S426R	probably benign	Het
Myo16	C	T	8: 10,476,094	T878I	probably damaging	Het
Myo9a	T	A	9: 59,861,472	Y912*	probably null	Het
Ncor1	A	C	11: 62,343,341	I669R	probably damaging	Het
Ndufs1	T	C	1: 63,163,776	I210V	probably benign	Het
Nek9	A	G	12: 85,310,420	C657R	probably damaging	Het
Noct	C	T	3: 51,250,021	T260I	probably damaging	Het
Nr1h4	A	T	10: 89,498,180	M102K	probably benign	Het
Obscn	G	A	11: 59,124,761	R1054C	possibly damaging	Het
Olfr1124	T	A	2: 87,435,152	F222I	probably benign	Het
Olfr352	C	A	2: 36,869,988	Q141K	probably benign	Het
Olfr47	A	G	6: 43,236,456	M283V	possibly damaging	Het
Olfr501-ps1	G	A	7: 108,508,243	M62I	probably damaging	Het
Olfr615	T	A	7: 103,561,317	I280N	possibly damaging	Het
Olfr619	A	T	7: 103,603,656	M1L	probably benign	Het
Otol1	C	A	3: 70,018,878	Q129K	probably benign	Het
Otx1	A	T	11: 21,998,532		probably null	Het
Pcdhac2	C	A	18: 37,146,251	N761K	probably damaging	Het
Pde1c	A	T	6: 56,150,624	M452K	probably damaging	Het
Phkg2	T	C	7: 127,573,941	Y24H	probably damaging	Het
Pigr	G	A	1: 130,841,817	D122N	probably benign	Het
Prg4	C	T	1: 150,460,681	C97Y	probably damaging	Het
Ptdss1	T	C	13: 66,945,288	V64A	probably benign	Het
Ralgapa2	T	C	2: 146,447,311	K324E	probably damaging	Het
Rfx5	G	A	3: 94,955,815	V73I	probably benign	Het
Riiad1	T	C	3: 94,472,863	T42A	probably benign	Het
Rims2	T	C	15: 39,454,445	V640A	possibly damaging	Het
Rnpep	G	T	1: 135,263,032	S592Y	possibly damaging	Het
Scap	T	C	9: 110,378,390	L431P	probably damaging	Het
Skint1	T	C	4: 112,028,333		probably null	Het
Slc44a1	A	G	4: 53,543,644	E396G	probably damaging	Het
Slc4a2	T	C	5: 24,434,869	F521S	probably damaging	Het
Smarcc1	T	A	9: 110,175,061	S394R	probably damaging	Het
Socs1	A	G	16: 10,784,685	S63P	probably benign	Het
Sun1	T	G	5: 139,225,333	S20A	possibly damaging	Het
Tac4	A	T	11: 95,265,242	K50*	probably null	Het
Tcaf2	A	G	6: 42,642,640	I151T	probably damaging	Het
Tcf4	T	C	18: 69,681,769	V587A	probably damaging	Het
Ttc37	T	A	13: 76,182,936	M1495K	probably damaging	Het
Ttn	T	A	2: 76,740,909	K24801*	probably null	Het
Tuba3b	G	T	6: 145,621,273	M413I	possibly damaging	Het
Ufl1	C	T	4: 25,267,832	A280T	possibly damaging	Het
Ugt2b5	T	A	5: 87,139,673	I212L	probably benign	Het
Umodl1	A	G	17: 30,986,485	T685A	probably benign	Het
Uqcrc1	T	A	9: 108,944,810	V183D	probably damaging	Het
Ush2a	A	G	1: 188,910,720	N4093S	probably benign	Het
Vmn1r167	C	T	7: 23,505,228	S121N	probably damaging	Het
Vmn1r47	A	G	6: 90,022,758	S291G	possibly damaging	Het
Vmn2r108	A	G	17: 20,481,187	V17A	probably benign	Het
Vmn2r58	T	A	7: 41,837,752	H573L	probably benign	Het
Xirp1	C	T	9: 120,018,792	V342I	probably damaging	Het
Zfp462	A	G	4: 55,051,204	M2226V	possibly damaging	Het
Zfp467	G	A	6: 48,439,029	H230Y	probably damaging	Het
Zfp595	T	A	13: 67,316,401	K599N	probably damaging	Het
Zfp819	C	A	7: 43,617,296	T401K	probably benign	Het

Other mutations in Siglec1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Siglec1	APN	2	131079325	missense	probably benign	0.03
IGL01092:Siglec1	APN	2	131079217	missense	probably damaging	1.00
IGL01115:Siglec1	APN	2	131074502	missense	probably benign	0.01
IGL01324:Siglec1	APN	2	131085541	missense	probably damaging	1.00
IGL01330:Siglec1	APN	2	131083536	missense	probably damaging	1.00
IGL01330:Siglec1	APN	2	131075005	nonsense	probably null
IGL01558:Siglec1	APN	2	131078499	missense	probably damaging	0.96
IGL01632:Siglec1	APN	2	131083820	missense	probably benign	0.03
IGL01768:Siglec1	APN	2	131074394	missense	probably benign
IGL02399:Siglec1	APN	2	131071178	missense	probably benign	0.16
IGL02558:Siglec1	APN	2	131074995	missense	possibly damaging	0.88
IGL02794:Siglec1	APN	2	131075969	missense	possibly damaging	0.86
IGL02839:Siglec1	APN	2	131084932	missense	possibly damaging	0.82
aggressor	UTSW	2	131083941	nonsense	probably null
hoodlum	UTSW	2	131072747	missense	possibly damaging	0.88
K3955:Siglec1	UTSW	2	131081439	missense	probably benign	0.00
P0038:Siglec1	UTSW	2	131081439	missense	probably benign	0.00
PIT4576001:Siglec1	UTSW	2	131078161	missense	probably damaging	1.00
PIT4677001:Siglec1	UTSW	2	131072757	missense	probably damaging	1.00
R0003:Siglec1	UTSW	2	131075060	missense	probably benign	0.00
R0048:Siglec1	UTSW	2	131073397	missense	possibly damaging	0.65
R0048:Siglec1	UTSW	2	131073397	missense	possibly damaging	0.65
R0243:Siglec1	UTSW	2	131085476	missense	probably damaging	1.00
R0276:Siglec1	UTSW	2	131083941	nonsense	probably null
R0379:Siglec1	UTSW	2	131074525	splice site	probably benign
R0464:Siglec1	UTSW	2	131079359	missense	probably damaging	1.00
R0507:Siglec1	UTSW	2	131074525	splice site	probably benign
R0560:Siglec1	UTSW	2	131070346	missense	probably benign	0.02
R0620:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R0621:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R0853:Siglec1	UTSW	2	131085022	missense	probably damaging	0.98
R1079:Siglec1	UTSW	2	131079377	nonsense	probably null
R1169:Siglec1	UTSW	2	131074827	missense	probably damaging	0.97
R1205:Siglec1	UTSW	2	131080464	missense	possibly damaging	0.94
R1293:Siglec1	UTSW	2	131073531	missense	probably benign	0.00
R1470:Siglec1	UTSW	2	131070387	missense	probably benign	0.19
R1470:Siglec1	UTSW	2	131070387	missense	probably benign	0.19
R1533:Siglec1	UTSW	2	131076158	missense	probably benign
R1717:Siglec1	UTSW	2	131073956	missense	possibly damaging	0.92
R1717:Siglec1	UTSW	2	131084012	missense	probably damaging	1.00
R1744:Siglec1	UTSW	2	131081299	missense	probably damaging	1.00
R1852:Siglec1	UTSW	2	131081500	missense	probably damaging	0.98
R1941:Siglec1	UTSW	2	131078131	missense	possibly damaging	0.94
R2011:Siglec1	UTSW	2	131083357	missense	probably damaging	1.00
R2012:Siglec1	UTSW	2	131083357	missense	probably damaging	1.00
R2128:Siglec1	UTSW	2	131080497	missense	probably damaging	1.00
R2278:Siglec1	UTSW	2	131071337	missense	probably benign	0.28
R2403:Siglec1	UTSW	2	131074475	missense	possibly damaging	0.65
R2449:Siglec1	UTSW	2	131078725	missense	probably benign	0.44
R2885:Siglec1	UTSW	2	131072747	missense	possibly damaging	0.88
R4213:Siglec1	UTSW	2	131074118	missense	probably damaging	1.00
R4274:Siglec1	UTSW	2	131085814	missense	probably benign	0.00
R4679:Siglec1	UTSW	2	131073411	missense	possibly damaging	0.87
R4715:Siglec1	UTSW	2	131074436	missense	probably damaging	1.00
R4782:Siglec1	UTSW	2	131075923	missense	probably damaging	1.00
R4896:Siglec1	UTSW	2	131069869	missense	probably benign	0.21
R5004:Siglec1	UTSW	2	131069869	missense	probably benign	0.21
R5004:Siglec1	UTSW	2	131073411	missense	possibly damaging	0.87
R5105:Siglec1	UTSW	2	131080400	missense	possibly damaging	0.69
R5137:Siglec1	UTSW	2	131081344	missense	probably damaging	1.00
R5153:Siglec1	UTSW	2	131085577	missense	probably damaging	0.99
R5311:Siglec1	UTSW	2	131079316	missense	probably damaging	1.00
R5600:Siglec1	UTSW	2	131085583	missense	probably benign	0.01
R5682:Siglec1	UTSW	2	131084010	missense	probably damaging	1.00
R5732:Siglec1	UTSW	2	131074268	missense	probably benign	0.30
R5870:Siglec1	UTSW	2	131072847	missense	probably damaging	0.99
R5898:Siglec1	UTSW	2	131073633	missense	probably damaging	1.00
R5909:Siglec1	UTSW	2	131077964	missense	probably damaging	1.00
R6488:Siglec1	UTSW	2	131081307	missense	probably damaging	0.99
R6920:Siglec1	UTSW	2	131078077	nonsense	probably null
R7064:Siglec1	UTSW	2	131083914	missense	probably benign	0.00
R7270:Siglec1	UTSW	2	131081551	missense	possibly damaging	0.67
R7355:Siglec1	UTSW	2	131080451	missense	probably benign	0.02
R7400:Siglec1	UTSW	2	131086095	missense	possibly damaging	0.73
R7470:Siglec1	UTSW	2	131075824	missense	probably benign	0.00
R7568:Siglec1	UTSW	2	131072682	missense	probably damaging	1.00
R7781:Siglec1	UTSW	2	131081338	missense	probably damaging	1.00
R7853:Siglec1	UTSW	2	131081292	missense	probably damaging	1.00
R7999:Siglec1	UTSW	2	131071163	missense	probably benign	0.28
R8191:Siglec1	UTSW	2	131085679	missense	probably damaging	1.00
R8274:Siglec1	UTSW	2	131083910	missense	probably benign
R8345:Siglec1	UTSW	2	131078578	missense	possibly damaging	0.95
X0024:Siglec1	UTSW	2	131080491	missense	probably damaging	1.00
Z1176:Siglec1	UTSW	2	131078745	missense	probably damaging	0.99
Z1176:Siglec1	UTSW	2	131080524	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- TGAGAGCCATGCCTTCTTAAGC -3'
(R):5'- CTCATGGTCGTGATTCAGTGC -3'

Sequencing Primer
(F):5'- CCATGCCTTCTTAAGCAGATTAGGG -3'
(R):5'- TGATTCAGTGCACCGTGGAC -3'

Posted On

2016-05-10