Mutagenetix > Incidental Mutations

Incidental Mutation 'R4993:Ncor1'

385035

Institutional Source

Beutler Lab

Gene Symbol

Ncor1

Ensembl Gene

ENSMUSG00000018501

Gene Name

nuclear receptor co-repressor 1

Synonyms

5730405M06Rik, A230020K14Rik, Rxrip13, N-CoR

MMRRC Submission

042587-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4993 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

62316426-62458541 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 62343341 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Arginine at position 669 (I669R)

Ref Sequence

ENSEMBL: ENSMUSP00000122654 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000037575] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000151498] [ENSMUST00000155712]

Predicted Effect

probably damaging
Transcript: ENSMUST00000018645
AA Change: I1400R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: I1400R

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
Pfam:GPS2_interact	150	239	1.4e-37	PFAM
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000037575
AA Change: I345R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000038900
Gene: ENSMUSG00000018501
AA Change: I345R

Domain	Start	End	E-Value	Type
low complexity region	28	41	N/A	INTRINSIC
low complexity region	461	472	N/A	INTRINSIC
coiled coil region	658	695	N/A	INTRINSIC
low complexity region	780	794	N/A	INTRINSIC
low complexity region	915	926	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
PDB:3N00\|B	1010	1030	2e-7	PDB
low complexity region	1032	1047	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
PDB:2OVM\|B	1212	1235	2e-8	PDB
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101066
AA Change: I1400R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: I1400R

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	710	731	N/A	INTRINSIC
low complexity region	771	788	N/A	INTRINSIC
low complexity region	888	899	N/A	INTRINSIC
low complexity region	987	995	N/A	INTRINSIC
low complexity region	1002	1013	N/A	INTRINSIC
low complexity region	1036	1049	N/A	INTRINSIC
internal_repeat_2	1061	1298	1.62e-6	PROSPERO
internal_repeat_2	1299	1515	1.62e-6	PROSPERO
low complexity region	1516	1527	N/A	INTRINSIC
coiled coil region	1712	1749	N/A	INTRINSIC
low complexity region	1834	1848	N/A	INTRINSIC
low complexity region	1969	1980	N/A	INTRINSIC
low complexity region	2036	2055	N/A	INTRINSIC
PDB:3N00\|B	2064	2084	4e-7	PDB
low complexity region	2086	2101	N/A	INTRINSIC
low complexity region	2157	2168	N/A	INTRINSIC
PDB:2OVM\|B	2267	2290	2e-8	PDB
low complexity region	2311	2324	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000101067
AA Change: I1332R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: I1332R

Domain	Start	End	E-Value	Type
low complexity region	51	74	N/A	INTRINSIC
coiled coil region	176	217	N/A	INTRINSIC
coiled coil region	302	329	N/A	INTRINSIC
low complexity region	349	366	N/A	INTRINSIC
SANT	437	485	2.76e-7	SMART
coiled coil region	507	544	N/A	INTRINSIC
low complexity region	593	617	N/A	INTRINSIC
SANT	624	672	3.29e-14	SMART
low complexity region	716	734	N/A	INTRINSIC
low complexity region	838	849	N/A	INTRINSIC
low complexity region	937	945	N/A	INTRINSIC
low complexity region	952	963	N/A	INTRINSIC
low complexity region	986	999	N/A	INTRINSIC
low complexity region	1448	1459	N/A	INTRINSIC
coiled coil region	1645	1682	N/A	INTRINSIC
low complexity region	1767	1781	N/A	INTRINSIC
low complexity region	1902	1913	N/A	INTRINSIC
low complexity region	1969	1988	N/A	INTRINSIC
PDB:3N00\|B	1997	2017	4e-7	PDB
low complexity region	2019	2034	N/A	INTRINSIC
low complexity region	2089	2100	N/A	INTRINSIC
PDB:2OVM\|B	2199	2222	2e-8	PDB
low complexity region	2243	2256	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000151498

SMART Domains

Protein: ENSMUSP00000125317
Gene: ENSMUSG00000018501

Domain	Start	End	E-Value	Type
SANT	37	85	2.76e-7	SMART
coiled coil region	107	144	N/A	INTRINSIC
low complexity region	193	217	N/A	INTRINSIC
SANT	224	272	3.29e-14	SMART
low complexity region	316	337	N/A	INTRINSIC
low complexity region	361	378	N/A	INTRINSIC
low complexity region	478	489	N/A	INTRINSIC
low complexity region	577	585	N/A	INTRINSIC
low complexity region	592	603	N/A	INTRINSIC
low complexity region	684	697	N/A	INTRINSIC
internal_repeat_2	700	830	5.77e-7	PROSPERO
internal_repeat_2	855	961	5.77e-7	PROSPERO

Predicted Effect

probably damaging
Transcript: ENSMUST00000155712
AA Change: I669R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501
AA Change: I669R

Domain	Start	End	E-Value	Type
low complexity region	26	47	N/A	INTRINSIC
low complexity region	87	104	N/A	INTRINSIC
low complexity region	204	215	N/A	INTRINSIC
low complexity region	303	311	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	352	365	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
coiled coil region	982	1019	N/A	INTRINSIC
low complexity region	1104	1118	N/A	INTRINSIC
low complexity region	1239	1250	N/A	INTRINSIC
low complexity region	1306	1325	N/A	INTRINSIC
PDB:3N00\|B	1334	1354	3e-7	PDB
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1427	1438	N/A	INTRINSIC
PDB:2OVM\|B	1537	1560	2e-8	PDB
low complexity region	1581	1594	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000156740
AA Change: I334R

SMART Domains

Protein: ENSMUSP00000125458
Gene: ENSMUSG00000018501
AA Change: I334R

Domain	Start	End	E-Value	Type
low complexity region	18	31	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
coiled coil region	647	684	N/A	INTRINSIC
low complexity region	770	784	N/A	INTRINSIC
low complexity region	905	916	N/A	INTRINSIC
low complexity region	972	991	N/A	INTRINSIC
PDB:3N00\|B	1000	1020	2e-7	PDB
low complexity region	1022	1037	N/A	INTRINSIC
low complexity region	1092	1103	N/A	INTRINSIC
PDB:2OVM\|B	1202	1225	2e-8	PDB
low complexity region	1246	1259	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159224

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161432

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
9130008F23Rik	G	T	17: 40,880,161	Q126K	probably benign	Het
Abca15	C	A	7: 120,401,718	N1492K	probably damaging	Het
Afap1l2	C	T	19: 56,918,040	D402N	probably damaging	Het
Akap11	A	G	14: 78,512,968	F660L	probably damaging	Het
Bcl3	T	C	7: 19,820,177	T89A	probably benign	Het
Bub1b	T	C	2: 118,636,770	I858T	possibly damaging	Het
Cdk19	A	G	10: 40,476,218	D288G	possibly damaging	Het
Cyp2d34	T	A	15: 82,618,329	D202V	probably damaging	Het
Dip2c	T	G	13: 9,575,223	Y584*	probably null	Het
Dpf3	A	T	12: 83,331,861		probably null	Het
Drp2	G	A	X: 134,441,316	R567H	probably damaging	Homo
Emid1	G	T	11: 5,131,512	Q212K	probably benign	Het
Esm1	C	T	13: 113,213,399	Q118*	probably null	Het
Fahd2a	T	G	2: 127,436,364	I308L	probably benign	Het
Fam208a	T	A	14: 27,429,114	W16R	possibly damaging	Het
Fanci	T	C	7: 79,435,378	*851Q	probably null	Het
Fastkd1	C	A	2: 69,702,740	V428F	probably damaging	Het
Fat2	A	T	11: 55,283,092	I2265N	probably damaging	Het
Gale	C	A	4: 135,966,860	H191Q	probably damaging	Het
Ghsr	T	A	3: 27,372,254	V153E	possibly damaging	Het
Gm10696	C	T	3: 94,176,316	G63R	probably damaging	Het
Gpc6	A	G	14: 117,624,539	N289S	possibly damaging	Het
Hoxb6	A	T	11: 96,300,711	Y153F	probably damaging	Het
Ints3	T	C	3: 90,415,507	T139A	probably benign	Het
Irf2bp2	A	G	8: 126,592,671	S256P	probably benign	Het
Klf4	G	T	4: 55,530,640	P148Q	probably damaging	Het
Loxl1	T	G	9: 58,312,537	H117P	probably damaging	Het
Lpl	A	G	8: 68,895,793	K225E	probably benign	Het
Lrba	T	A	3: 86,360,037	V1678D	probably damaging	Het
Med1	A	T	11: 98,163,904	F398Y	probably damaging	Het
Mfap2	T	C	4: 141,015,578	*186Q	probably null	Het
Mfsd3	T	C	15: 76,701,982	L105P	probably damaging	Het
Mlxip	T	G	5: 123,395,294	I122S	probably damaging	Het
Mmrn2	A	T	14: 34,396,398	Y107F	probably damaging	Het
Mtg1	G	T	7: 140,140,283	D88Y	probably null	Het
Mutyh	T	A	4: 116,817,935	S426R	probably benign	Het
Myo16	C	T	8: 10,476,094	T878I	probably damaging	Het
Myo9a	T	A	9: 59,861,472	Y912*	probably null	Het
Ndufs1	T	C	1: 63,163,776	I210V	probably benign	Het
Nek9	A	G	12: 85,310,420	C657R	probably damaging	Het
Noct	C	T	3: 51,250,021	T260I	probably damaging	Het
Nr1h4	A	T	10: 89,498,180	M102K	probably benign	Het
Obscn	G	A	11: 59,124,761	R1054C	possibly damaging	Het
Olfr1124	T	A	2: 87,435,152	F222I	probably benign	Het
Olfr352	C	A	2: 36,869,988	Q141K	probably benign	Het
Olfr47	A	G	6: 43,236,456	M283V	possibly damaging	Het
Olfr501-ps1	G	A	7: 108,508,243	M62I	probably damaging	Het
Olfr615	T	A	7: 103,561,317	I280N	possibly damaging	Het
Olfr619	A	T	7: 103,603,656	M1L	probably benign	Het
Otol1	C	A	3: 70,018,878	Q129K	probably benign	Het
Otx1	A	T	11: 21,998,532		probably null	Het
Pcdhac2	C	A	18: 37,146,251	N761K	probably damaging	Het
Pde1c	A	T	6: 56,150,624	M452K	probably damaging	Het
Phkg2	T	C	7: 127,573,941	Y24H	probably damaging	Het
Pigr	G	A	1: 130,841,817	D122N	probably benign	Het
Prg4	C	T	1: 150,460,681	C97Y	probably damaging	Het
Ptdss1	T	C	13: 66,945,288	V64A	probably benign	Het
Ralgapa2	T	C	2: 146,447,311	K324E	probably damaging	Het
Rfx5	G	A	3: 94,955,815	V73I	probably benign	Het
Riiad1	T	C	3: 94,472,863	T42A	probably benign	Het
Rims2	T	C	15: 39,454,445	V640A	possibly damaging	Het
Rnpep	G	T	1: 135,263,032	S592Y	possibly damaging	Het
Scap	T	C	9: 110,378,390	L431P	probably damaging	Het
Siglec1	T	A	2: 131,073,361	I1437F	possibly damaging	Het
Skint1	T	C	4: 112,028,333		probably null	Het
Slc44a1	A	G	4: 53,543,644	E396G	probably damaging	Het
Slc4a2	T	C	5: 24,434,869	F521S	probably damaging	Het
Smarcc1	T	A	9: 110,175,061	S394R	probably damaging	Het
Socs1	A	G	16: 10,784,685	S63P	probably benign	Het
Sun1	T	G	5: 139,225,333	S20A	possibly damaging	Het
Tac4	A	T	11: 95,265,242	K50*	probably null	Het
Tcaf2	A	G	6: 42,642,640	I151T	probably damaging	Het
Tcf4	T	C	18: 69,681,769	V587A	probably damaging	Het
Ttc37	T	A	13: 76,182,936	M1495K	probably damaging	Het
Ttn	T	A	2: 76,740,909	K24801*	probably null	Het
Tuba3b	G	T	6: 145,621,273	M413I	possibly damaging	Het
Ufl1	C	T	4: 25,267,832	A280T	possibly damaging	Het
Ugt2b5	T	A	5: 87,139,673	I212L	probably benign	Het
Umodl1	A	G	17: 30,986,485	T685A	probably benign	Het
Uqcrc1	T	A	9: 108,944,810	V183D	probably damaging	Het
Ush2a	A	G	1: 188,910,720	N4093S	probably benign	Het
Vmn1r167	C	T	7: 23,505,228	S121N	probably damaging	Het
Vmn1r47	A	G	6: 90,022,758	S291G	possibly damaging	Het
Vmn2r108	A	G	17: 20,481,187	V17A	probably benign	Het
Vmn2r58	T	A	7: 41,837,752	H573L	probably benign	Het
Xirp1	C	T	9: 120,018,792	V342I	probably damaging	Het
Zfp462	A	G	4: 55,051,204	M2226V	possibly damaging	Het
Zfp467	G	A	6: 48,439,029	H230Y	probably damaging	Het
Zfp595	T	A	13: 67,316,401	K599N	probably damaging	Het
Zfp819	C	A	7: 43,617,296	T401K	probably benign	Het

Other mutations in Ncor1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01067:Ncor1	APN	11	62392528	missense	probably damaging	1.00
IGL01343:Ncor1	APN	11	62325486	critical splice donor site	probably null
IGL01392:Ncor1	APN	11	62340594	missense	probably damaging	0.99
IGL01402:Ncor1	APN	11	62340474	missense	probably damaging	1.00
IGL01714:Ncor1	APN	11	62334584	missense	possibly damaging	0.58
IGL01772:Ncor1	APN	11	62349347	intron	probably benign
IGL01889:Ncor1	APN	11	62334601	missense	possibly damaging	0.69
IGL02058:Ncor1	APN	11	62344637	missense	probably damaging	1.00
IGL02065:Ncor1	APN	11	62419609	missense	possibly damaging	0.95
IGL02073:Ncor1	APN	11	62358917	missense	probably damaging	0.99
IGL02176:Ncor1	APN	11	62329659	unclassified	probably benign
IGL02288:Ncor1	APN	11	62349403	missense	probably benign	0.01
IGL02348:Ncor1	APN	11	62333659	splice site	probably benign
IGL02608:Ncor1	APN	11	62373214	missense	probably benign	0.07
LCD18:Ncor1	UTSW	11	62419782	critical splice acceptor site	probably benign
PIT4382001:Ncor1	UTSW	11	62344663	missense	probably damaging	0.96
PIT4576001:Ncor1	UTSW	11	62333717	missense	probably damaging	0.99
R0026:Ncor1	UTSW	11	62438429	missense	probably damaging	1.00
R0038:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R0038:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R0103:Ncor1	UTSW	11	62343045	missense	possibly damaging	0.85
R0103:Ncor1	UTSW	11	62343045	missense	possibly damaging	0.85
R0144:Ncor1	UTSW	11	62392595	missense	probably damaging	1.00
R0427:Ncor1	UTSW	11	62410920	missense	probably damaging	1.00
R0501:Ncor1	UTSW	11	62373322	missense	possibly damaging	0.73
R0544:Ncor1	UTSW	11	62333776	missense	probably damaging	1.00
R0544:Ncor1	UTSW	11	62333777	missense	probably damaging	1.00
R0563:Ncor1	UTSW	11	62343230	missense	probably damaging	0.97
R1074:Ncor1	UTSW	11	62392551	missense	probably damaging	0.99
R1266:Ncor1	UTSW	11	62334040	missense	probably damaging	0.98
R1444:Ncor1	UTSW	11	62403806	missense	probably damaging	1.00
R1452:Ncor1	UTSW	11	62334631	missense	probably damaging	1.00
R1534:Ncor1	UTSW	11	62378504	missense	possibly damaging	0.92
R1710:Ncor1	UTSW	11	62423005	missense	probably damaging	1.00
R1762:Ncor1	UTSW	11	62384784	missense	possibly damaging	0.82
R1771:Ncor1	UTSW	11	62327112	missense	probably damaging	1.00
R1864:Ncor1	UTSW	11	62381419	missense	probably damaging	1.00
R1902:Ncor1	UTSW	11	62338158	missense	probably damaging	1.00
R1906:Ncor1	UTSW	11	62349385	missense	possibly damaging	0.81
R2009:Ncor1	UTSW	11	62325601	missense	probably benign	0.43
R3708:Ncor1	UTSW	11	62344687	missense	probably damaging	1.00
R3825:Ncor1	UTSW	11	62373357	missense	probably benign	0.00
R3923:Ncor1	UTSW	11	62325616	missense	probably damaging	1.00
R3966:Ncor1	UTSW	11	62344757	missense	probably damaging	1.00
R4049:Ncor1	UTSW	11	62329668	splice site	probably null
R4350:Ncor1	UTSW	11	62410818	critical splice donor site	probably null
R4351:Ncor1	UTSW	11	62410818	critical splice donor site	probably null
R4359:Ncor1	UTSW	11	62358910	missense	probably damaging	1.00
R4712:Ncor1	UTSW	11	62344834	missense	probably damaging	1.00
R4723:Ncor1	UTSW	11	62378612	missense	probably benign	0.26
R4863:Ncor1	UTSW	11	62392638	missense	possibly damaging	0.92
R4875:Ncor1	UTSW	11	62433611	small deletion	probably benign
R4956:Ncor1	UTSW	11	62340605	missense	probably damaging	1.00
R5079:Ncor1	UTSW	11	62345237	missense	possibly damaging	0.92
R5144:Ncor1	UTSW	11	62349464	missense	probably damaging	1.00
R5223:Ncor1	UTSW	11	62339000	missense	probably damaging	1.00
R5243:Ncor1	UTSW	11	62338962	missense	probably damaging	1.00
R5271:Ncor1	UTSW	11	62340545	missense	probably damaging	1.00
R5285:Ncor1	UTSW	11	62392649	missense	probably damaging	1.00
R5533:Ncor1	UTSW	11	62343011	missense	probably benign	0.00
R5580:Ncor1	UTSW	11	62389778	nonsense	probably null
R5593:Ncor1	UTSW	11	62369304	missense	probably damaging	1.00
R5609:Ncor1	UTSW	11	62358853	splice site	probably null
R5632:Ncor1	UTSW	11	62338234	missense	possibly damaging	0.85
R5830:Ncor1	UTSW	11	62344763	missense	possibly damaging	0.71
R5896:Ncor1	UTSW	11	62383190	missense	probably damaging	1.00
R5973:Ncor1	UTSW	11	62349310	splice site	probably null
R6013:Ncor1	UTSW	11	62321077	missense	probably benign
R6019:Ncor1	UTSW	11	62373161	missense	probably benign	0.00
R6032:Ncor1	UTSW	11	62373321	missense	possibly damaging	0.54
R6032:Ncor1	UTSW	11	62373321	missense	possibly damaging	0.54
R6075:Ncor1	UTSW	11	62317849	missense	probably damaging	1.00
R6091:Ncor1	UTSW	11	62419617	missense	probably damaging	0.98
R6248:Ncor1	UTSW	11	62366982	missense	probably damaging	1.00
R6281:Ncor1	UTSW	11	62373545	missense	possibly damaging	0.71
R6351:Ncor1	UTSW	11	62373298	missense	probably benign	0.30
R6469:Ncor1	UTSW	11	62343302	missense	probably damaging	1.00
R6502:Ncor1	UTSW	11	62381414	nonsense	probably null
R6614:Ncor1	UTSW	11	62330819	missense	probably benign	0.01
R6650:Ncor1	UTSW	11	62334541	missense	probably damaging	1.00
R6765:Ncor1	UTSW	11	62373446	missense	probably benign	0.01
R6852:Ncor1	UTSW	11	62343245	missense	probably damaging	0.97
R6909:Ncor1	UTSW	11	62329486	missense	probably damaging	1.00
R6965:Ncor1	UTSW	11	62353233	critical splice donor site	probably null
R7054:Ncor1	UTSW	11	62384793	missense	probably null
R7248:Ncor1	UTSW	11	62384772	missense	possibly damaging	0.89
R7352:Ncor1	UTSW	11	62333911	missense	probably damaging	0.99
R7396:Ncor1	UTSW	11	62343218	missense	probably damaging	0.99
R7434:Ncor1	UTSW	11	62383199	missense	probably damaging	0.99
R7552:Ncor1	UTSW	11	62373424	missense	possibly damaging	0.53
R7565:Ncor1	UTSW	11	62401265	missense	probably damaging	1.00
R7575:Ncor1	UTSW	11	62383256	missense	probably benign	0.21
R7622:Ncor1	UTSW	11	62317968	missense	probably benign	0.00
R7664:Ncor1	UTSW	11	62398328	missense	probably damaging	1.00
R7814:Ncor1	UTSW	11	62333926	missense	probably damaging	0.99
R7963:Ncor1	UTSW	11	62334533	missense	probably benign	0.28
R7990:Ncor1	UTSW	11	62349495	critical splice acceptor site	probably null
R8302:Ncor1	UTSW	11	62333855	missense	probably benign	0.00
R8334:Ncor1	UTSW	11	62383244	missense	probably damaging	0.99
R8512:Ncor1	UTSW	11	62433611	small deletion	probably benign
X0065:Ncor1	UTSW	11	62354569	critical splice donor site	probably null
X0065:Ncor1	UTSW	11	62358991	missense	probably benign	0.23
Z1176:Ncor1	UTSW	11	62438516	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CTTCGTGAAGTGTAGACCTGAG -3'
(R):5'- CACAGTTTGAGGTGACTAATTTGGG -3'

Sequencing Primer
(F):5'- AGAGCTCACCACTGACGTGTG -3'
(R):5'- AGGTGACTAATTTGGGAGTGTG -3'

Posted On

2016-05-10