Incidental Mutation 'R4993:Drp2'
ID385063
Institutional Source Beutler Lab
Gene Symbol Drp2
Ensembl Gene ENSMUSG00000000223
Gene Namedystrophin related protein 2
Synonyms
MMRRC Submission 042587-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R4993 (G1)
Quality Score222
Status Not validated
ChromosomeX
Chromosomal Location134404551-134456573 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 134441316 bp
ZygosityHomozygous
Amino Acid Change Arginine to Histidine at position 567 (R567H)
Ref Sequence ENSEMBL: ENSMUSP00000108850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113224] [ENSMUST00000113226] [ENSMUST00000113228] [ENSMUST00000153424]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000000228
Predicted Effect probably damaging
Transcript: ENSMUST00000113224
AA Change: R567H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108850
Gene: ENSMUSG00000000223
AA Change: R567H

DomainStartEndE-ValueType
SPEC 129 251 5e-7 SMART
SPEC 258 360 6.4e-7 SMART
WW 377 409 4.6e-10 SMART
Pfam:EF-hand_2 410 528 9.5e-36 PFAM
Pfam:EF-hand_3 532 623 9.1e-35 PFAM
ZnF_ZZ 628 673 1e-17 SMART
coiled coil region 800 900 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113226
AA Change: R543H

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108852
Gene: ENSMUSG00000000223
AA Change: R543H

DomainStartEndE-ValueType
SPEC 105 227 7.58e-5 SMART
SPEC 234 336 1e-4 SMART
WW 353 385 8.03e-8 SMART
Pfam:EF-hand_3 508 599 2e-35 PFAM
ZnF_ZZ 604 649 2.03e-15 SMART
coiled coil region 776 876 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113228
AA Change: R543H

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108854
Gene: ENSMUSG00000000223
AA Change: R543H

DomainStartEndE-ValueType
SPEC 105 227 7.58e-5 SMART
SPEC 234 336 1e-4 SMART
WW 353 385 8.03e-8 SMART
Pfam:EF-hand_3 508 599 2e-35 PFAM
ZnF_ZZ 604 649 2.03e-15 SMART
coiled coil region 776 876 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153424
AA Change: R543H

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115246
Gene: ENSMUSG00000000223
AA Change: R543H

DomainStartEndE-ValueType
SPEC 105 227 7.58e-5 SMART
SPEC 234 336 1e-4 SMART
WW 353 385 8.03e-8 SMART
Pfam:EF-hand_3 508 599 2e-35 PFAM
ZnF_ZZ 604 649 2.03e-15 SMART
coiled coil region 776 876 N/A INTRINSIC
Meta Mutation Damage Score 0.3772 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the dystrophin family of proteins perform a critical role in the maintenance of membrane-associated complexes at points of intercellular contact in vertebrate cells. The protein encoded by this gene is predicted to resemble certain short C-terminal isoforms of dystrophin and dystrophin-related protein 1 (DRP1 or utrophin). DRP2 is expressed principally in the brain and spinal cord. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a conditional allele activated in peripheral nerves exhibit abnormal Scwann cell morphology, supernumerary Schwann cell, abnormal myelin sheath morphology and hypermyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
9130008F23Rik G T 17: 40,880,161 Q126K probably benign Het
Abca15 C A 7: 120,401,718 N1492K probably damaging Het
Afap1l2 C T 19: 56,918,040 D402N probably damaging Het
Akap11 A G 14: 78,512,968 F660L probably damaging Het
Bcl3 T C 7: 19,820,177 T89A probably benign Het
Bub1b T C 2: 118,636,770 I858T possibly damaging Het
Cdk19 A G 10: 40,476,218 D288G possibly damaging Het
Cyp2d34 T A 15: 82,618,329 D202V probably damaging Het
Dip2c T G 13: 9,575,223 Y584* probably null Het
Dpf3 A T 12: 83,331,861 probably null Het
Emid1 G T 11: 5,131,512 Q212K probably benign Het
Esm1 C T 13: 113,213,399 Q118* probably null Het
Fahd2a T G 2: 127,436,364 I308L probably benign Het
Fam208a T A 14: 27,429,114 W16R possibly damaging Het
Fanci T C 7: 79,435,378 *851Q probably null Het
Fastkd1 C A 2: 69,702,740 V428F probably damaging Het
Fat2 A T 11: 55,283,092 I2265N probably damaging Het
Gale C A 4: 135,966,860 H191Q probably damaging Het
Ghsr T A 3: 27,372,254 V153E possibly damaging Het
Gm10696 C T 3: 94,176,316 G63R probably damaging Het
Gpc6 A G 14: 117,624,539 N289S possibly damaging Het
Hoxb6 A T 11: 96,300,711 Y153F probably damaging Het
Ints3 T C 3: 90,415,507 T139A probably benign Het
Irf2bp2 A G 8: 126,592,671 S256P probably benign Het
Klf4 G T 4: 55,530,640 P148Q probably damaging Het
Loxl1 T G 9: 58,312,537 H117P probably damaging Het
Lpl A G 8: 68,895,793 K225E probably benign Het
Lrba T A 3: 86,360,037 V1678D probably damaging Het
Med1 A T 11: 98,163,904 F398Y probably damaging Het
Mfap2 T C 4: 141,015,578 *186Q probably null Het
Mfsd3 T C 15: 76,701,982 L105P probably damaging Het
Mlxip T G 5: 123,395,294 I122S probably damaging Het
Mmrn2 A T 14: 34,396,398 Y107F probably damaging Het
Mtg1 G T 7: 140,140,283 D88Y probably null Het
Mutyh T A 4: 116,817,935 S426R probably benign Het
Myo16 C T 8: 10,476,094 T878I probably damaging Het
Myo9a T A 9: 59,861,472 Y912* probably null Het
Ncor1 A C 11: 62,343,341 I669R probably damaging Het
Ndufs1 T C 1: 63,163,776 I210V probably benign Het
Nek9 A G 12: 85,310,420 C657R probably damaging Het
Noct C T 3: 51,250,021 T260I probably damaging Het
Nr1h4 A T 10: 89,498,180 M102K probably benign Het
Obscn G A 11: 59,124,761 R1054C possibly damaging Het
Olfr1124 T A 2: 87,435,152 F222I probably benign Het
Olfr352 C A 2: 36,869,988 Q141K probably benign Het
Olfr47 A G 6: 43,236,456 M283V possibly damaging Het
Olfr501-ps1 G A 7: 108,508,243 M62I probably damaging Het
Olfr615 T A 7: 103,561,317 I280N possibly damaging Het
Olfr619 A T 7: 103,603,656 M1L probably benign Het
Otol1 C A 3: 70,018,878 Q129K probably benign Het
Otx1 A T 11: 21,998,532 probably null Het
Pcdhac2 C A 18: 37,146,251 N761K probably damaging Het
Pde1c A T 6: 56,150,624 M452K probably damaging Het
Phkg2 T C 7: 127,573,941 Y24H probably damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Prg4 C T 1: 150,460,681 C97Y probably damaging Het
Ptdss1 T C 13: 66,945,288 V64A probably benign Het
Ralgapa2 T C 2: 146,447,311 K324E probably damaging Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Riiad1 T C 3: 94,472,863 T42A probably benign Het
Rims2 T C 15: 39,454,445 V640A possibly damaging Het
Rnpep G T 1: 135,263,032 S592Y possibly damaging Het
Scap T C 9: 110,378,390 L431P probably damaging Het
Siglec1 T A 2: 131,073,361 I1437F possibly damaging Het
Skint1 T C 4: 112,028,333 probably null Het
Slc44a1 A G 4: 53,543,644 E396G probably damaging Het
Slc4a2 T C 5: 24,434,869 F521S probably damaging Het
Smarcc1 T A 9: 110,175,061 S394R probably damaging Het
Socs1 A G 16: 10,784,685 S63P probably benign Het
Sun1 T G 5: 139,225,333 S20A possibly damaging Het
Tac4 A T 11: 95,265,242 K50* probably null Het
Tcaf2 A G 6: 42,642,640 I151T probably damaging Het
Tcf4 T C 18: 69,681,769 V587A probably damaging Het
Ttc37 T A 13: 76,182,936 M1495K probably damaging Het
Ttn T A 2: 76,740,909 K24801* probably null Het
Tuba3b G T 6: 145,621,273 M413I possibly damaging Het
Ufl1 C T 4: 25,267,832 A280T possibly damaging Het
Ugt2b5 T A 5: 87,139,673 I212L probably benign Het
Umodl1 A G 17: 30,986,485 T685A probably benign Het
Uqcrc1 T A 9: 108,944,810 V183D probably damaging Het
Ush2a A G 1: 188,910,720 N4093S probably benign Het
Vmn1r167 C T 7: 23,505,228 S121N probably damaging Het
Vmn1r47 A G 6: 90,022,758 S291G possibly damaging Het
Vmn2r108 A G 17: 20,481,187 V17A probably benign Het
Vmn2r58 T A 7: 41,837,752 H573L probably benign Het
Xirp1 C T 9: 120,018,792 V342I probably damaging Het
Zfp462 A G 4: 55,051,204 M2226V possibly damaging Het
Zfp467 G A 6: 48,439,029 H230Y probably damaging Het
Zfp595 T A 13: 67,316,401 K599N probably damaging Het
Zfp819 C A 7: 43,617,296 T401K probably benign Het
Other mutations in Drp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1119:Drp2 UTSW X 134441322 missense probably damaging 1.00
R1864:Drp2 UTSW X 134427115 missense probably benign 0.03
R3618:Drp2 UTSW X 134439968 missense probably benign 0.13
R4367:Drp2 UTSW X 134435135 intron probably benign
R4371:Drp2 UTSW X 134435135 intron probably benign
R4994:Drp2 UTSW X 134441316 missense probably damaging 0.99
R4996:Drp2 UTSW X 134441316 missense probably damaging 0.99
Z1177:Drp2 UTSW X 134437042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGTTCAACAGTGCAGTATGC -3'
(R):5'- TGTTGCCCCATCTCAACAAAG -3'

Sequencing Primer
(F):5'- AGTTCAACAGTGCAGTATGCTCTTTC -3'
(R):5'- AAAGCTCCTGTACCTCTGAGTAC -3'
Posted On2016-05-10