Mutagenetix > Incidental Mutation

Incidental Mutation 'R4994:Pigr'

385065

Institutional Source

Beutler Lab

Gene Symbol

Pigr

Ensembl Gene

ENSMUSG00000026417

Gene Name

polymeric immunoglobulin receptor

Synonyms

MMRRC Submission

042588-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R4994 (G1)

Quality Score

224

Status

Validated

Chromosome

Chromosomal Location

130826684-130852249 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 130841817 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 122 (D122N)

Ref Sequence

ENSEMBL: ENSMUSP00000121686 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027675] [ENSMUST00000133792] [ENSMUST00000137782]

AlphaFold

O70570

Predicted Effect

probably benign
Transcript: ENSMUST00000027675
AA Change: D122N

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000027675
Gene: ENSMUSG00000026417
AA Change: D122N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	25	128	1.6e-8	SMART
IG	137	238	8.1e-8	SMART
IG	242	346	1.4e-3	SMART
IG	355	457	3.1e-5	SMART
IG	469	563	1e-10	SMART
IG_like	483	548	8e-3	SMART
low complexity region	627	644	N/A	INTRINSIC
transmembrane domain	646	668	N/A	INTRINSIC
low complexity region	730	746	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000133792
AA Change: D122N

PolyPhen 2 Score 0.264 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000121686
Gene: ENSMUSG00000026417
AA Change: D122N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	25	128	1.6e-8	SMART
Blast:IG	137	210	3e-47	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000137782
AA Change: D122N

PolyPhen 2 Score 0.257 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000114334
Gene: ENSMUSG00000026417
AA Change: D122N

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IG	25	128	3.91e-6	SMART
Blast:IG	137	201	4e-40	BLAST

Meta Mutation Damage Score

0.3843

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the immunoglobulin superfamily. The encoded poly-Ig receptor binds polymeric immunoglobulin molecules at the basolateral surface of epithelial cells; the complex is then transported across the cell to be secreted at the apical surface. A significant association was found between immunoglobulin A nephropathy and several SNPs in this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Nullizygous mice show impaired transepithelial transport of dimeric IgA, increased serum IgA levels and mucosal leakiness. Studies of one null allele show increased susceptibility to mycobacterial infections while another allele causes impaired clearanceof the protozoan parasite Giardia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	C	A	9: 94,537,433	R148L	probably benign	Het
1700030K09Rik	A	G	8: 72,455,118	E364G	probably benign	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Abcb4	A	G	5: 8,928,524	T557A	probably damaging	Het
Acadm	C	T	3: 153,929,584	E298K	probably damaging	Het
Adrb3	T	C	8: 27,227,827		probably null	Het
Aldh1b1	A	G	4: 45,803,128	Y222C	possibly damaging	Het
Ankrd6	A	G	4: 32,860,387	Y19H	probably damaging	Het
Arhgap21	T	A	2: 20,849,890	T1554S	probably benign	Het
BC043934	T	C	9: 96,437,120		noncoding transcript	Het
Birc6	A	G	17: 74,594,324		probably benign	Het
Blm	A	C	7: 80,458,825	F1357C	probably benign	Het
Cd209a	T	C	8: 3,747,713		probably null	Het
Cdk7	G	A	13: 100,717,595	H129Y	probably damaging	Het
Clec14a	G	T	12: 58,268,284	P184Q	probably damaging	Het
Cma1	T	A	14: 55,941,671	I243F	probably damaging	Het
Cntnap3	G	T	13: 64,761,984	T769K	possibly damaging	Het
Col5a1	A	C	2: 28,032,739	K273T	possibly damaging	Het
Csnk1e	A	G	15: 79,424,929	Y266H	probably damaging	Het
Cyb5d1	A	G	11: 69,393,771	L185S	probably damaging	Het
Dennd5b	T	C	6: 149,041,500		probably null	Het
Drp2	G	A	X: 134,441,316	R567H	probably damaging	Homo
Dzank1	T	G	2: 144,522,566	D37A	probably damaging	Het
Echdc2	A	G	4: 108,165,628	I34V	probably benign	Het
Esm1	A	T	13: 113,213,431	R128S	probably benign	Het
Fbrsl1	A	G	5: 110,447,951	S73P	probably damaging	Het
Fbxo18	T	A	2: 11,764,230	I251F	probably damaging	Het
Fbxo6	A	T	4: 148,149,491	S49R	probably damaging	Het
Gm13089	T	A	4: 143,698,369	Q168L	possibly damaging	Het
Gm17093	A	T	14: 44,519,322	Q82L	probably damaging	Het
Hmcn2	T	C	2: 31,458,055		probably null	Het
Hspa4l	C	A	3: 40,745,649		probably benign	Het
Il3ra	G	A	14: 14,351,080	A201T	probably benign	Het
Irx5	T	A	8: 92,360,781	V447E	probably damaging	Het
Kif14	G	T	1: 136,482,959	L668F	probably damaging	Het
Lag3	T	A	6: 124,904,453	R519W	unknown	Het
Lgr4	A	G	2: 110,011,938	N756S	probably damaging	Het
Lingo4	A	G	3: 94,402,541	H262R	probably benign	Het
Lingo4	T	A	3: 94,403,001	H415Q	probably benign	Het
Lkaaear1	C	A	2: 181,697,583	G25*	probably null	Het
Marf1	T	C	16: 14,114,231	K1641E	probably benign	Het
Mtfmt	T	C	9: 65,443,851		probably benign	Het
Mtif3	G	A	5: 146,956,788	T203M	probably benign	Het
Mycbp2	A	G	14: 103,169,994	I2740T	probably benign	Het
Nrd1	A	G	4: 109,046,612	T720A	probably benign	Het
Olfr715	T	C	7: 107,129,064	T110A	probably benign	Het
Peak1	T	A	9: 56,241,276	D32V	possibly damaging	Het
Plekhg3	A	G	12: 76,565,537	R391G	possibly damaging	Het
Ppfia3	T	C	7: 45,341,118	D919G	probably damaging	Het
Rnase2b	T	A	14: 51,162,751	D96E	possibly damaging	Het
Rsf1	CGGCGGC	CGGCGGCCGCGGCGGC	7: 97,579,923		probably benign	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Serpina3f	A	G	12: 104,220,356	T394A	probably benign	Het
Six3	A	G	17: 85,621,292	N18S	possibly damaging	Het
Slc12a5	T	A	2: 164,983,365		probably null	Het
Slc35f6	A	G	5: 30,648,083	N21S	probably damaging	Het
Slc39a6	A	T	18: 24,596,294	I454N	probably damaging	Het
Slc40a1	T	A	1: 45,909,664	E485D	probably damaging	Het
Sort1	G	A	3: 108,328,069	C255Y	probably damaging	Het
Stab2	T	A	10: 86,949,907	T624S	probably benign	Het
Stk33	T	A	7: 109,340,398	I99L	probably benign	Het
Taf4b	T	A	18: 14,898,043	I828N	probably damaging	Het
Terf2	T	C	8: 107,076,478		probably benign	Het
Timd4	C	T	11: 46,815,517	R49C	probably damaging	Het
Tmem57	A	G	4: 134,828,299	Y288H	probably damaging	Het
Tpte	T	C	8: 22,318,346	S166P	probably benign	Het
Trabd2b	T	C	4: 114,406,855	L13P	probably benign	Het
Trappc11	A	T	8: 47,522,441	Y247*	probably null	Het
Trnt1	C	T	6: 106,778,892	Q303*	probably null	Het
Tspyl5	T	A	15: 33,687,055	Q248L	possibly damaging	Het
Ubxn7	A	T	16: 32,381,504	K337N	probably damaging	Het
Unc13a	T	A	8: 71,643,172	I1234F	probably benign	Het
Vmn1r127	A	T	7: 21,319,018	F282I	probably damaging	Het
Wdhd1	A	T	14: 47,268,654		probably null	Het
Zfp605	A	G	5: 110,127,486	K157E	probably damaging	Het
Zhx2	T	A	15: 57,821,359	D41E	probably benign	Het

Other mutations in Pigr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Pigr	APN	1	130834430	start codon destroyed	probably null	1.00
IGL01565:Pigr	APN	1	130844474	missense	possibly damaging	0.93
IGL01592:Pigr	APN	1	130849058	missense	probably damaging	1.00
IGL02153:Pigr	APN	1	130849056	splice site	probably null
IGL02508:Pigr	APN	1	130850858	missense	probably benign	0.02
IGL02815:Pigr	APN	1	130841821	missense	probably damaging	1.00
R0834:Pigr	UTSW	1	130844544	nonsense	probably null
R1453:Pigr	UTSW	1	130841544	missense	probably benign	0.00
R1728:Pigr	UTSW	1	130844522	missense	possibly damaging	0.50
R1729:Pigr	UTSW	1	130844522	missense	possibly damaging	0.50
R1730:Pigr	UTSW	1	130844522	missense	possibly damaging	0.50
R1736:Pigr	UTSW	1	130841803	missense	possibly damaging	0.71
R1739:Pigr	UTSW	1	130844522	missense	possibly damaging	0.50
R1742:Pigr	UTSW	1	130845086	missense	probably damaging	1.00
R1762:Pigr	UTSW	1	130844522	missense	possibly damaging	0.50
R1783:Pigr	UTSW	1	130844522	missense	possibly damaging	0.50
R1784:Pigr	UTSW	1	130844522	missense	possibly damaging	0.50
R1785:Pigr	UTSW	1	130844522	missense	possibly damaging	0.50
R1929:Pigr	UTSW	1	130846662	unclassified	probably benign
R2065:Pigr	UTSW	1	130850880	missense	probably benign	0.20
R2275:Pigr	UTSW	1	130846470	missense	probably benign	0.00
R2513:Pigr	UTSW	1	130846620	missense	possibly damaging	0.71
R2910:Pigr	UTSW	1	130849533	missense	probably damaging	1.00
R2911:Pigr	UTSW	1	130849533	missense	probably damaging	1.00
R2964:Pigr	UTSW	1	130841535	missense	probably damaging	1.00
R3857:Pigr	UTSW	1	130847261	missense	probably benign	0.06
R4165:Pigr	UTSW	1	130841817	missense	probably benign	0.26
R4166:Pigr	UTSW	1	130841817	missense	probably benign	0.26
R4303:Pigr	UTSW	1	130841817	missense	probably benign	0.26
R4735:Pigr	UTSW	1	130846554	missense	probably damaging	0.99
R4909:Pigr	UTSW	1	130848458	missense	possibly damaging	0.77
R4993:Pigr	UTSW	1	130841817	missense	probably benign	0.26
R5033:Pigr	UTSW	1	130844699	missense	probably damaging	1.00
R5116:Pigr	UTSW	1	130849031	missense	probably benign	0.00
R5304:Pigr	UTSW	1	130849493	missense	probably benign	0.00
R5440:Pigr	UTSW	1	130849622	splice site	probably null
R5853:Pigr	UTSW	1	130846604	nonsense	probably null
R5934:Pigr	UTSW	1	130844527	missense	probably damaging	0.98
R6015:Pigr	UTSW	1	130847261	missense	probably benign	0.06
R6291:Pigr	UTSW	1	130841761	missense	probably benign	0.06
R6749:Pigr	UTSW	1	130846548	missense	probably benign	0.14
R6941:Pigr	UTSW	1	130847327	missense	probably damaging	1.00
R7369:Pigr	UTSW	1	130841766	missense	probably benign	0.00
R7391:Pigr	UTSW	1	130849566	missense	probably damaging	1.00
R7564:Pigr	UTSW	1	130841666	missense	possibly damaging	0.67
R7760:Pigr	UTSW	1	130846631	missense	possibly damaging	0.59
R7995:Pigr	UTSW	1	130841686	missense	probably damaging	1.00
R8094:Pigr	UTSW	1	130846510	missense	probably damaging	1.00
R8096:Pigr	UTSW	1	130846510	missense	probably damaging	1.00
R9068:Pigr	UTSW	1	130846494	missense	probably damaging	0.96
R9312:Pigr	UTSW	1	130834448	missense	probably benign	0.16
R9460:Pigr	UTSW	1	130844666	missense	probably damaging	1.00
R9578:Pigr	UTSW	1	130849613	missense	probably benign	0.36
R9743:Pigr	UTSW	1	130841803	missense	possibly damaging	0.71
Z1176:Pigr	UTSW	1	130850815	missense	possibly damaging	0.76

Predicted Primers

PCR Primer
(F):5'- CGCTCATCTCTTCAAATGGC -3'
(R):5'- ACGACATGGTAAGTCTCACCC -3'

Sequencing Primer
(F):5'- TTCAAATGGCTACCTCTCCAAG -3'
(R):5'- GACATGGTAAGTCTCACCCATTCC -3'

Posted On

2016-05-10