Incidental Mutation 'R4994:Hmcn2'
ID 385070
Institutional Source Beutler Lab
Gene Symbol Hmcn2
Ensembl Gene ENSMUSG00000055632
Gene Name hemicentin 2
Synonyms
MMRRC Submission 042588-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4994 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 31314415-31460738 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 31458055 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109160 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113532] [ENSMUST00000226996]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000113532
SMART Domains Protein: ENSMUSP00000109160
Gene: ENSMUSG00000055632

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 37 211 1.21e-1 SMART
Blast:IG_like 263 340 2e-38 BLAST
IG 434 515 7.36e-2 SMART
IGc2 530 595 1.91e-9 SMART
IGc2 621 685 4.81e-15 SMART
IGc2 711 773 1.09e-13 SMART
IGc2 799 866 2.72e-14 SMART
IGc2 894 959 1.95e-15 SMART
IGc2 985 1049 5e-13 SMART
IGc2 1082 1147 1.09e-13 SMART
low complexity region 1151 1169 N/A INTRINSIC
IGc2 1173 1232 7.07e-13 SMART
IGc2 1260 1326 4.31e-17 SMART
IGc2 1354 1428 3e-16 SMART
IGc2 1456 1522 1.82e-15 SMART
IGc2 1550 1615 2.7e-18 SMART
IGc2 1644 1708 1.3e-11 SMART
IGc2 1736 1801 6.69e-14 SMART
IG 1826 1917 2.31e0 SMART
IGc2 1932 1997 4.62e-17 SMART
IGc2 2024 2091 3.25e-12 SMART
IGc2 2117 2182 1.28e-10 SMART
IGc2 2209 2276 3.76e-8 SMART
IGc2 2305 2370 2.6e-11 SMART
IGc2 2399 2464 1.32e-12 SMART
IGc2 2492 2557 2.06e-14 SMART
IGc2 2588 2653 3.9e-15 SMART
IGc2 2686 2751 2.64e-12 SMART
IGc2 2797 2862 9.05e-11 SMART
IGc2 2892 2957 4.7e-9 SMART
IGc2 2984 3049 1.44e-13 SMART
IGc2 3079 3144 9.33e-13 SMART
IGc2 3171 3236 3.79e-13 SMART
IGc2 3264 3331 1.85e-16 SMART
IGc2 3360 3425 9.61e-15 SMART
low complexity region 3433 3445 N/A INTRINSIC
IGc2 3453 3514 5.83e-14 SMART
IGc2 3542 3600 1.76e-8 SMART
low complexity region 3613 3627 N/A INTRINSIC
IGc2 3628 3693 5.2e-11 SMART
IGc2 3719 3784 2.64e-12 SMART
IGc2 3810 3877 3.35e-5 SMART
IGc2 3903 3968 3.73e-12 SMART
IGc2 3994 4058 4.39e-9 SMART
IGc2 4084 4149 1.79e-14 SMART
low complexity region 4157 4169 N/A INTRINSIC
IGc2 4175 4238 9.33e-13 SMART
IGc2 4265 4329 7.22e-19 SMART
IGc2 4355 4419 1.59e-15 SMART
Pfam:G2F 4431 4613 1.7e-56 PFAM
EGF_CA 4668 4708 5.78e-11 SMART
EGF_CA 4709 4753 9.39e-11 SMART
EGF_CA 4754 4796 7.69e-7 SMART
EGF_CA 4797 4837 2.19e-11 SMART
EGF_CA 4904 4943 6.74e-12 SMART
EGF_like 4944 4989 1.87e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138821
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142448
Predicted Effect probably benign
Transcript: ENSMUST00000226996
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C A 9: 94,537,433 R148L probably benign Het
1700030K09Rik A G 8: 72,455,118 E364G probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 A G 5: 8,928,524 T557A probably damaging Het
Acadm C T 3: 153,929,584 E298K probably damaging Het
Adrb3 T C 8: 27,227,827 probably null Het
Aldh1b1 A G 4: 45,803,128 Y222C possibly damaging Het
Ankrd6 A G 4: 32,860,387 Y19H probably damaging Het
Arhgap21 T A 2: 20,849,890 T1554S probably benign Het
BC043934 T C 9: 96,437,120 noncoding transcript Het
Birc6 A G 17: 74,594,324 probably benign Het
Blm A C 7: 80,458,825 F1357C probably benign Het
Cd209a T C 8: 3,747,713 probably null Het
Cdk7 G A 13: 100,717,595 H129Y probably damaging Het
Clec14a G T 12: 58,268,284 P184Q probably damaging Het
Cma1 T A 14: 55,941,671 I243F probably damaging Het
Cntnap3 G T 13: 64,761,984 T769K possibly damaging Het
Col5a1 A C 2: 28,032,739 K273T possibly damaging Het
Csnk1e A G 15: 79,424,929 Y266H probably damaging Het
Cyb5d1 A G 11: 69,393,771 L185S probably damaging Het
Dennd5b T C 6: 149,041,500 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Dzank1 T G 2: 144,522,566 D37A probably damaging Het
Echdc2 A G 4: 108,165,628 I34V probably benign Het
Esm1 A T 13: 113,213,431 R128S probably benign Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fbxo18 T A 2: 11,764,230 I251F probably damaging Het
Fbxo6 A T 4: 148,149,491 S49R probably damaging Het
Gm13089 T A 4: 143,698,369 Q168L possibly damaging Het
Gm17093 A T 14: 44,519,322 Q82L probably damaging Het
Hspa4l C A 3: 40,745,649 probably benign Het
Il3ra G A 14: 14,351,080 A201T probably benign Het
Irx5 T A 8: 92,360,781 V447E probably damaging Het
Kif14 G T 1: 136,482,959 L668F probably damaging Het
Lag3 T A 6: 124,904,453 R519W unknown Het
Lgr4 A G 2: 110,011,938 N756S probably damaging Het
Lingo4 A G 3: 94,402,541 H262R probably benign Het
Lingo4 T A 3: 94,403,001 H415Q probably benign Het
Lkaaear1 C A 2: 181,697,583 G25* probably null Het
Marf1 T C 16: 14,114,231 K1641E probably benign Het
Mtfmt T C 9: 65,443,851 probably benign Het
Mtif3 G A 5: 146,956,788 T203M probably benign Het
Mycbp2 A G 14: 103,169,994 I2740T probably benign Het
Nrd1 A G 4: 109,046,612 T720A probably benign Het
Olfr715 T C 7: 107,129,064 T110A probably benign Het
Peak1 T A 9: 56,241,276 D32V possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Plekhg3 A G 12: 76,565,537 R391G possibly damaging Het
Ppfia3 T C 7: 45,341,118 D919G probably damaging Het
Rnase2b T A 14: 51,162,751 D96E possibly damaging Het
Rsf1 CGGCGGC CGGCGGCCGCGGCGGC 7: 97,579,923 probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Serpina3f A G 12: 104,220,356 T394A probably benign Het
Six3 A G 17: 85,621,292 N18S possibly damaging Het
Slc12a5 T A 2: 164,983,365 probably null Het
Slc35f6 A G 5: 30,648,083 N21S probably damaging Het
Slc39a6 A T 18: 24,596,294 I454N probably damaging Het
Slc40a1 T A 1: 45,909,664 E485D probably damaging Het
Sort1 G A 3: 108,328,069 C255Y probably damaging Het
Stab2 T A 10: 86,949,907 T624S probably benign Het
Stk33 T A 7: 109,340,398 I99L probably benign Het
Taf4b T A 18: 14,898,043 I828N probably damaging Het
Terf2 T C 8: 107,076,478 probably benign Het
Timd4 C T 11: 46,815,517 R49C probably damaging Het
Tmem57 A G 4: 134,828,299 Y288H probably damaging Het
Tpte T C 8: 22,318,346 S166P probably benign Het
Trabd2b T C 4: 114,406,855 L13P probably benign Het
Trappc11 A T 8: 47,522,441 Y247* probably null Het
Trnt1 C T 6: 106,778,892 Q303* probably null Het
Tspyl5 T A 15: 33,687,055 Q248L possibly damaging Het
Ubxn7 A T 16: 32,381,504 K337N probably damaging Het
Unc13a T A 8: 71,643,172 I1234F probably benign Het
Vmn1r127 A T 7: 21,319,018 F282I probably damaging Het
Wdhd1 A T 14: 47,268,654 probably null Het
Zfp605 A G 5: 110,127,486 K157E probably damaging Het
Zhx2 T A 15: 57,821,359 D41E probably benign Het
Other mutations in Hmcn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00965:Hmcn2 APN 2 31343096 missense probably damaging 1.00
IGL00966:Hmcn2 APN 2 31428994 missense probably damaging 0.97
IGL00973:Hmcn2 APN 2 31383821 intron probably benign
IGL01364:Hmcn2 APN 2 31361814 nonsense probably null
IGL01486:Hmcn2 APN 2 31336621 missense probably damaging 1.00
IGL01530:Hmcn2 APN 2 31354264 missense possibly damaging 0.85
IGL01550:Hmcn2 APN 2 31424252 missense possibly damaging 0.84
IGL01710:Hmcn2 APN 2 31343102 missense probably damaging 1.00
IGL01764:Hmcn2 APN 2 31405630 missense possibly damaging 0.93
IGL01924:Hmcn2 APN 2 31398917 missense probably benign 0.00
IGL02003:Hmcn2 APN 2 31428982 missense possibly damaging 0.90
IGL02117:Hmcn2 APN 2 31457173 missense possibly damaging 0.75
IGL02205:Hmcn2 APN 2 31400127 missense probably damaging 1.00
IGL02273:Hmcn2 APN 2 31424377 missense probably benign 0.06
IGL02313:Hmcn2 APN 2 31453605 missense possibly damaging 0.68
IGL02326:Hmcn2 APN 2 31450952 missense probably damaging 0.97
IGL02486:Hmcn2 APN 2 31420095 missense probably damaging 0.98
IGL02551:Hmcn2 APN 2 31454811 missense possibly damaging 0.83
IGL02695:Hmcn2 APN 2 31408973 missense possibly damaging 0.87
IGL02725:Hmcn2 APN 2 31405528 missense probably damaging 1.00
IGL02792:Hmcn2 APN 2 31346590 missense probably damaging 1.00
IGL02882:Hmcn2 APN 2 31413367 nonsense probably null
IGL03003:Hmcn2 APN 2 31433486 missense probably damaging 0.98
IGL03067:Hmcn2 APN 2 31346630 missense probably damaging 1.00
IGL03137:Hmcn2 APN 2 31362230 missense probably damaging 0.98
IGL03220:Hmcn2 APN 2 31346621 missense possibly damaging 0.94
IGL03411:Hmcn2 APN 2 31346637 missense possibly damaging 0.83
PIT4544001:Hmcn2 UTSW 2 31428250 missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31412508 missense probably damaging 0.98
R0044:Hmcn2 UTSW 2 31412508 missense probably damaging 0.98
R0048:Hmcn2 UTSW 2 31428237 missense possibly damaging 0.92
R0048:Hmcn2 UTSW 2 31428237 missense possibly damaging 0.92
R0078:Hmcn2 UTSW 2 31388344 missense probably damaging 1.00
R0090:Hmcn2 UTSW 2 31426198 missense probably damaging 1.00
R0173:Hmcn2 UTSW 2 31438331 critical splice donor site probably null
R0257:Hmcn2 UTSW 2 31369164 splice site probably benign
R0266:Hmcn2 UTSW 2 31394827 missense probably benign 0.03
R0266:Hmcn2 UTSW 2 31445353 splice site probably benign
R0326:Hmcn2 UTSW 2 31423225 nonsense probably null
R0366:Hmcn2 UTSW 2 31424206 missense possibly damaging 0.88
R0400:Hmcn2 UTSW 2 31400129 missense probably damaging 0.98
R0412:Hmcn2 UTSW 2 31388247 missense probably damaging 0.98
R0436:Hmcn2 UTSW 2 31405612 missense probably damaging 1.00
R0457:Hmcn2 UTSW 2 31415284 critical splice donor site probably null
R0487:Hmcn2 UTSW 2 31386677 missense possibly damaging 0.60
R0568:Hmcn2 UTSW 2 31415236 missense probably benign 0.02
R0755:Hmcn2 UTSW 2 31453160 missense probably damaging 0.99
R0811:Hmcn2 UTSW 2 31420371 missense probably damaging 0.99
R0812:Hmcn2 UTSW 2 31420371 missense probably damaging 0.99
R0964:Hmcn2 UTSW 2 31391511 missense probably benign 0.23
R0988:Hmcn2 UTSW 2 31335451 missense probably damaging 1.00
R1484:Hmcn2 UTSW 2 31346495 missense probably damaging 1.00
R1509:Hmcn2 UTSW 2 31314479 missense possibly damaging 0.86
R1535:Hmcn2 UTSW 2 31420407 missense possibly damaging 0.91
R1574:Hmcn2 UTSW 2 31404887 missense probably damaging 0.97
R1574:Hmcn2 UTSW 2 31404887 missense probably damaging 0.97
R1600:Hmcn2 UTSW 2 31430787 missense probably damaging 0.98
R1623:Hmcn2 UTSW 2 31458039 missense possibly damaging 0.84
R1692:Hmcn2 UTSW 2 31450844 missense possibly damaging 0.47
R1719:Hmcn2 UTSW 2 31354721 missense probably damaging 1.00
R1747:Hmcn2 UTSW 2 31457985 missense probably benign 0.00
R1756:Hmcn2 UTSW 2 31396120 missense probably damaging 0.99
R1763:Hmcn2 UTSW 2 31314590 missense probably damaging 1.00
R1815:Hmcn2 UTSW 2 31393043 missense probably damaging 0.97
R1822:Hmcn2 UTSW 2 31383692 missense probably damaging 0.99
R1858:Hmcn2 UTSW 2 31415283 critical splice donor site probably null
R1895:Hmcn2 UTSW 2 31405635 missense probably damaging 0.99
R1908:Hmcn2 UTSW 2 31411910 critical splice donor site probably null
R1946:Hmcn2 UTSW 2 31405635 missense probably damaging 0.99
R1966:Hmcn2 UTSW 2 31389329 missense probably damaging 0.99
R2007:Hmcn2 UTSW 2 31438255 missense possibly damaging 0.91
R2050:Hmcn2 UTSW 2 31335436 missense probably damaging 1.00
R2055:Hmcn2 UTSW 2 31378282 missense probably benign 0.33
R2097:Hmcn2 UTSW 2 31380419 missense probably damaging 1.00
R2145:Hmcn2 UTSW 2 31333931 splice site probably benign
R2155:Hmcn2 UTSW 2 31460349 missense possibly damaging 0.68
R2170:Hmcn2 UTSW 2 31380281 missense probably benign 0.08
R2188:Hmcn2 UTSW 2 31419935 missense probably benign 0.14
R2208:Hmcn2 UTSW 2 31380297 missense probably damaging 1.00
R2217:Hmcn2 UTSW 2 31350574 missense probably benign 0.02
R2407:Hmcn2 UTSW 2 31335412 critical splice acceptor site probably null
R2764:Hmcn2 UTSW 2 31388298 missense probably damaging 0.98
R2913:Hmcn2 UTSW 2 31460210 missense possibly damaging 0.68
R2986:Hmcn2 UTSW 2 31360998 missense probably damaging 1.00
R3157:Hmcn2 UTSW 2 31400255 missense probably damaging 0.99
R3406:Hmcn2 UTSW 2 31433272 splice site probably benign
R3429:Hmcn2 UTSW 2 31409144 missense possibly damaging 0.87
R3737:Hmcn2 UTSW 2 31336612 nonsense probably null
R3739:Hmcn2 UTSW 2 31336612 nonsense probably null
R3771:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3772:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3773:Hmcn2 UTSW 2 31360896 missense probably damaging 0.99
R3804:Hmcn2 UTSW 2 31352885 splice site probably null
R3837:Hmcn2 UTSW 2 31413407 missense probably damaging 0.99
R3838:Hmcn2 UTSW 2 31413407 missense probably damaging 0.99
R3846:Hmcn2 UTSW 2 31430350 missense possibly damaging 0.51
R3925:Hmcn2 UTSW 2 31453157 missense probably benign 0.00
R3934:Hmcn2 UTSW 2 31380484 critical splice donor site probably null
R3946:Hmcn2 UTSW 2 31382394 missense possibly damaging 0.91
R4035:Hmcn2 UTSW 2 31336612 nonsense probably null
R4057:Hmcn2 UTSW 2 31400238 missense probably damaging 1.00
R4583:Hmcn2 UTSW 2 31413265 missense possibly damaging 0.84
R4623:Hmcn2 UTSW 2 31396710 missense probably damaging 1.00
R4647:Hmcn2 UTSW 2 31399019 missense possibly damaging 0.82
R4668:Hmcn2 UTSW 2 31435792 missense probably benign 0.40
R4669:Hmcn2 UTSW 2 31435792 missense probably benign 0.40
R4687:Hmcn2 UTSW 2 31438285 missense probably benign 0.14
R4735:Hmcn2 UTSW 2 31383775 missense probably benign 0.06
R4772:Hmcn2 UTSW 2 31445314 missense probably benign 0.02
R4866:Hmcn2 UTSW 2 31389391 missense possibly damaging 0.88
R4916:Hmcn2 UTSW 2 31360980 missense probably damaging 0.98
R4943:Hmcn2 UTSW 2 31335492 missense probably damaging 1.00
R4967:Hmcn2 UTSW 2 31354164 critical splice acceptor site probably null
R4973:Hmcn2 UTSW 2 31344096 missense probably benign 0.15
R4975:Hmcn2 UTSW 2 31393025 missense possibly damaging 0.88
R4997:Hmcn2 UTSW 2 31401708 missense probably damaging 1.00
R5045:Hmcn2 UTSW 2 31409081 missense probably damaging 1.00
R5117:Hmcn2 UTSW 2 31458049 missense possibly damaging 0.95
R5151:Hmcn2 UTSW 2 31389443 missense probably null
R5232:Hmcn2 UTSW 2 31457748 missense probably damaging 0.99
R5237:Hmcn2 UTSW 2 31414716 missense probably benign 0.01
R5288:Hmcn2 UTSW 2 31460321 missense probably benign 0.11
R5375:Hmcn2 UTSW 2 31430441 missense possibly damaging 0.92
R5379:Hmcn2 UTSW 2 31409011 missense probably damaging 0.99
R5385:Hmcn2 UTSW 2 31460321 missense probably benign 0.11
R5412:Hmcn2 UTSW 2 31346617 missense possibly damaging 0.77
R5426:Hmcn2 UTSW 2 31336544 missense possibly damaging 0.95
R5434:Hmcn2 UTSW 2 31420363 missense probably damaging 1.00
R5441:Hmcn2 UTSW 2 31406416 missense possibly damaging 0.82
R5484:Hmcn2 UTSW 2 31393054 nonsense probably null
R5492:Hmcn2 UTSW 2 31420306 missense probably benign 0.03
R5572:Hmcn2 UTSW 2 31414525 critical splice acceptor site probably null
R5572:Hmcn2 UTSW 2 31414526 critical splice acceptor site probably null
R5591:Hmcn2 UTSW 2 31344047 missense probably damaging 1.00
R5614:Hmcn2 UTSW 2 31428303 missense probably damaging 0.99
R5634:Hmcn2 UTSW 2 31333881 missense probably damaging 1.00
R5645:Hmcn2 UTSW 2 31420812 missense possibly damaging 0.92
R5716:Hmcn2 UTSW 2 31336567 missense probably damaging 1.00
R5716:Hmcn2 UTSW 2 31458738 missense possibly damaging 0.68
R5725:Hmcn2 UTSW 2 31383815 critical splice donor site probably null
R5760:Hmcn2 UTSW 2 31414568 missense possibly damaging 0.91
R5774:Hmcn2 UTSW 2 31409135 missense possibly damaging 0.94
R5838:Hmcn2 UTSW 2 31457807 missense probably damaging 0.99
R5899:Hmcn2 UTSW 2 31354673 missense possibly damaging 0.93
R5916:Hmcn2 UTSW 2 31396139 missense probably damaging 1.00
R5973:Hmcn2 UTSW 2 31420323 missense probably damaging 0.99
R6002:Hmcn2 UTSW 2 31420309 missense probably damaging 0.99
R6018:Hmcn2 UTSW 2 31370792 missense probably benign 0.13
R6063:Hmcn2 UTSW 2 31434713 missense probably benign 0.06
R6161:Hmcn2 UTSW 2 31356254 missense probably benign
R6166:Hmcn2 UTSW 2 31369262 missense probably damaging 1.00
R6177:Hmcn2 UTSW 2 31420106 nonsense probably null
R6191:Hmcn2 UTSW 2 31458746 missense probably damaging 0.99
R6195:Hmcn2 UTSW 2 31384115 missense probably damaging 0.96
R6273:Hmcn2 UTSW 2 31411834 missense probably damaging 0.99
R6293:Hmcn2 UTSW 2 31335451 missense probably damaging 1.00
R6349:Hmcn2 UTSW 2 31388373 missense probably damaging 1.00
R6395:Hmcn2 UTSW 2 31369257 missense probably damaging 1.00
R6448:Hmcn2 UTSW 2 31420820 missense probably benign 0.02
R6450:Hmcn2 UTSW 2 31361800 missense probably benign 0.11
R6479:Hmcn2 UTSW 2 31425468 missense probably damaging 0.99
R6502:Hmcn2 UTSW 2 31382478 missense probably damaging 0.99
R6511:Hmcn2 UTSW 2 31356342 missense possibly damaging 0.79
R6537:Hmcn2 UTSW 2 31415268 missense probably benign 0.00
R6880:Hmcn2 UTSW 2 31343056 missense probably damaging 1.00
R6924:Hmcn2 UTSW 2 31350505 splice site probably null
R6971:Hmcn2 UTSW 2 31432321 missense probably benign 0.02
R7057:Hmcn2 UTSW 2 31422649 missense probably damaging 0.99
R7141:Hmcn2 UTSW 2 31360896 missense probably benign 0.17
R7268:Hmcn2 UTSW 2 31457966 missense possibly damaging 0.48
R7307:Hmcn2 UTSW 2 31343081 missense probably damaging 0.96
R7322:Hmcn2 UTSW 2 31459081 missense probably damaging 0.99
R7334:Hmcn2 UTSW 2 31435794 missense probably damaging 0.98
R7334:Hmcn2 UTSW 2 31453135 missense possibly damaging 0.82
R7335:Hmcn2 UTSW 2 31392157 missense possibly damaging 0.88
R7358:Hmcn2 UTSW 2 31416812 missense probably damaging 1.00
R7359:Hmcn2 UTSW 2 31388383 missense probably benign 0.13
R7488:Hmcn2 UTSW 2 31420830 missense probably damaging 1.00
R7498:Hmcn2 UTSW 2 31383475 splice site probably null
R7560:Hmcn2 UTSW 2 31457173 missense probably benign
R7566:Hmcn2 UTSW 2 31454857 missense probably damaging 0.96
R7570:Hmcn2 UTSW 2 31423911 missense probably benign
R7574:Hmcn2 UTSW 2 31455519 missense possibly damaging 0.68
R7599:Hmcn2 UTSW 2 31356286 missense possibly damaging 0.93
R7654:Hmcn2 UTSW 2 31346569 missense probably benign 0.00
R7662:Hmcn2 UTSW 2 31382345 missense probably benign 0.01
R7666:Hmcn2 UTSW 2 31380233 missense probably damaging 1.00
R7698:Hmcn2 UTSW 2 31423153 missense probably damaging 0.98
R7722:Hmcn2 UTSW 2 31382500 nonsense probably null
R7739:Hmcn2 UTSW 2 31458026 missense possibly damaging 0.48
R7749:Hmcn2 UTSW 2 31453033 splice site probably null
R7828:Hmcn2 UTSW 2 31405875 missense possibly damaging 0.95
R7912:Hmcn2 UTSW 2 31420299 missense probably benign 0.00
R7978:Hmcn2 UTSW 2 31389347 missense probably benign 0.40
R8075:Hmcn2 UTSW 2 31389391 missense possibly damaging 0.88
R8088:Hmcn2 UTSW 2 31426903 nonsense probably null
R8101:Hmcn2 UTSW 2 31350070 missense probably benign 0.08
R8124:Hmcn2 UTSW 2 31400124 missense probably benign 0.01
R8145:Hmcn2 UTSW 2 31423105 missense probably damaging 1.00
R8230:Hmcn2 UTSW 2 31344473 missense possibly damaging 0.91
R8267:Hmcn2 UTSW 2 31459179 missense probably benign
R8277:Hmcn2 UTSW 2 31369177 missense probably benign 0.16
R8307:Hmcn2 UTSW 2 31396115 missense probably damaging 0.99
R8353:Hmcn2 UTSW 2 31385341 splice site probably null
R8415:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
R8416:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
R8437:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
R8438:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
R8440:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
R8442:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
R8497:Hmcn2 UTSW 2 31423345 missense possibly damaging 0.92
R8520:Hmcn2 UTSW 2 31354714 missense probably damaging 1.00
R8530:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
R8537:Hmcn2 UTSW 2 31391076 missense probably benign 0.15
R8550:Hmcn2 UTSW 2 31350642 critical splice donor site probably null
R8721:Hmcn2 UTSW 2 31425177 missense probably damaging 1.00
R8795:Hmcn2 UTSW 2 31425381 missense probably benign 0.01
R8802:Hmcn2 UTSW 2 31411276 missense probably damaging 0.97
R8804:Hmcn2 UTSW 2 31425381 missense probably benign 0.01
R8805:Hmcn2 UTSW 2 31425381 missense probably benign 0.01
R8904:Hmcn2 UTSW 2 31433392 missense possibly damaging 0.92
R8937:Hmcn2 UTSW 2 31314415 start codon destroyed probably benign 0.01
R8947:Hmcn2 UTSW 2 31388208 missense probably damaging 0.99
R8948:Hmcn2 UTSW 2 31354729 missense probably damaging 1.00
R8950:Hmcn2 UTSW 2 31354729 missense probably damaging 1.00
R8959:Hmcn2 UTSW 2 31392147 missense probably damaging 1.00
R9025:Hmcn2 UTSW 2 31457955 missense possibly damaging 0.56
R9039:Hmcn2 UTSW 2 31354634 missense probably damaging 0.97
R9068:Hmcn2 UTSW 2 31413673 missense probably benign 0.01
R9161:Hmcn2 UTSW 2 31352746 missense probably benign 0.02
R9178:Hmcn2 UTSW 2 31391509 missense possibly damaging 0.77
R9204:Hmcn2 UTSW 2 31388365 missense probably damaging 0.98
R9317:Hmcn2 UTSW 2 31460316 missense possibly damaging 0.91
R9341:Hmcn2 UTSW 2 31389347 missense probably benign 0.40
R9343:Hmcn2 UTSW 2 31389347 missense probably benign 0.40
R9355:Hmcn2 UTSW 2 31438290 missense probably benign 0.18
R9371:Hmcn2 UTSW 2 31411905 missense probably damaging 1.00
R9450:Hmcn2 UTSW 2 31426833 missense probably damaging 1.00
R9477:Hmcn2 UTSW 2 31396019 critical splice acceptor site probably null
R9483:Hmcn2 UTSW 2 31430363 missense
R9536:Hmcn2 UTSW 2 31445118 missense possibly damaging 0.86
R9580:Hmcn2 UTSW 2 31404863 missense probably benign 0.16
R9593:Hmcn2 UTSW 2 31354730 missense probably damaging 0.99
R9649:Hmcn2 UTSW 2 31402438 missense possibly damaging 0.95
R9706:Hmcn2 UTSW 2 31415267 missense probably benign 0.00
X0066:Hmcn2 UTSW 2 31454811 missense possibly damaging 0.83
X0067:Hmcn2 UTSW 2 31405867 missense possibly damaging 0.82
Z1088:Hmcn2 UTSW 2 31459064 splice site probably null
Z1088:Hmcn2 UTSW 2 31381067 missense probably benign 0.01
Z1176:Hmcn2 UTSW 2 31344029 missense possibly damaging 0.95
Z1176:Hmcn2 UTSW 2 31425416 missense probably damaging 1.00
Z1176:Hmcn2 UTSW 2 31429091 missense probably damaging 0.97
Z1177:Hmcn2 UTSW 2 31344506 missense probably damaging 1.00
Z1177:Hmcn2 UTSW 2 31426824 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACCATTGTCAGCCACCG -3'
(R):5'- GCATCATTTTAGGAGGGCCTC -3'

Sequencing Primer
(F):5'- ATTGTCAGCCACCGGAGCC -3'
(R):5'- ACGGTTTGAATATCACCCCAGTC -3'
Posted On 2016-05-10