Incidental Mutation 'R4994:Hspa4l'
ID 385076
Institutional Source Beutler Lab
Gene Symbol Hspa4l
Ensembl Gene ENSMUSG00000025757
Gene Name heat shock protein 4 like
Synonyms Osp94, APG-1, 94kDa
MMRRC Submission 042588-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.221) question?
Stock # R4994 (G1)
Quality Score 191
Status Validated
Chromosome 3
Chromosomal Location 40699814-40750538 bp(+) (GRCm39)
Type of Mutation utr 5 prime
DNA Base Change (assembly) C to A at 40700081 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108086] [ENSMUST00000203353] [ENSMUST00000203496] [ENSMUST00000203904] [ENSMUST00000204702]
AlphaFold P48722
Predicted Effect probably benign
Transcript: ENSMUST00000108086
SMART Domains Protein: ENSMUSP00000103721
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 11 673 2.1e-171 PFAM
Predicted Effect not run
Transcript: ENSMUST00000162279
AA Change: A110E
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203267
Predicted Effect probably benign
Transcript: ENSMUST00000203353
SMART Domains Protein: ENSMUSP00000144787
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 570 6.2e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203496
SMART Domains Protein: ENSMUSP00000145243
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 58 5.4e-16 PFAM
Pfam:HSP70 54 158 9.3e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203904
SMART Domains Protein: ENSMUSP00000145405
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 125 6.1e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204702
SMART Domains Protein: ENSMUSP00000145468
Gene: ENSMUSG00000025757

DomainStartEndE-ValueType
Pfam:HSP70 3 694 1.3e-192 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is heat shock inducible and may act as a chaperone. The encoded protein can protect the heat-shocked cell against the harmful effects of aggregated proteins. This gene is highly expressed in leukemia cells and may be a good target for therapeutic intervention. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased incidence of male infertility, due to reduced number of mature sperm and reduced sperm motility, and hydronephrosis development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700030K09Rik A G 8: 73,208,962 (GRCm39) E364G probably benign Het
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Abcb4 A G 5: 8,978,524 (GRCm39) T557A probably damaging Het
Acadm C T 3: 153,635,221 (GRCm39) E298K probably damaging Het
Adrb3 T C 8: 27,717,855 (GRCm39) probably null Het
Aldh1b1 A G 4: 45,803,128 (GRCm39) Y222C possibly damaging Het
Ankrd6 A G 4: 32,860,387 (GRCm39) Y19H probably damaging Het
Arhgap21 T A 2: 20,854,701 (GRCm39) T1554S probably benign Het
BC043934 T C 9: 96,319,173 (GRCm39) noncoding transcript Het
Birc6 A G 17: 74,901,319 (GRCm39) probably benign Het
Blm A C 7: 80,108,573 (GRCm39) F1357C probably benign Het
Cd209a T C 8: 3,797,713 (GRCm39) probably null Het
Cdk7 G A 13: 100,854,103 (GRCm39) H129Y probably damaging Het
Clec14a G T 12: 58,315,070 (GRCm39) P184Q probably damaging Het
Cma1 T A 14: 56,179,128 (GRCm39) I243F probably damaging Het
Cntnap3 G T 13: 64,909,798 (GRCm39) T769K possibly damaging Het
Col5a1 A C 2: 27,922,751 (GRCm39) K273T possibly damaging Het
Csnk1e A G 15: 79,309,129 (GRCm39) Y266H probably damaging Het
Cyb5d1 A G 11: 69,284,597 (GRCm39) L185S probably damaging Het
Dennd5b T C 6: 148,942,998 (GRCm39) probably null Het
Dipk2a C A 9: 94,419,486 (GRCm39) R148L probably benign Het
Drp2 G A X: 133,342,065 (GRCm39) R567H probably damaging Homo
Dzank1 T G 2: 144,364,486 (GRCm39) D37A probably damaging Het
Echdc2 A G 4: 108,022,825 (GRCm39) I34V probably benign Het
Esm1 A T 13: 113,349,965 (GRCm39) R128S probably benign Het
Fbh1 T A 2: 11,769,041 (GRCm39) I251F probably damaging Het
Fbrsl1 A G 5: 110,595,817 (GRCm39) S73P probably damaging Het
Fbxo6 A T 4: 148,233,948 (GRCm39) S49R probably damaging Het
Gm17093 A T 14: 44,756,779 (GRCm39) Q82L probably damaging Het
Hmcn2 T C 2: 31,348,067 (GRCm39) probably null Het
Il3ra G A 14: 14,351,080 (GRCm38) A201T probably benign Het
Irx5 T A 8: 93,087,409 (GRCm39) V447E probably damaging Het
Kif14 G T 1: 136,410,697 (GRCm39) L668F probably damaging Het
Lag3 T A 6: 124,881,416 (GRCm39) R519W unknown Het
Lgr4 A G 2: 109,842,283 (GRCm39) N756S probably damaging Het
Lingo4 A G 3: 94,309,848 (GRCm39) H262R probably benign Het
Lingo4 T A 3: 94,310,308 (GRCm39) H415Q probably benign Het
Lkaaear1 C A 2: 181,339,376 (GRCm39) G25* probably null Het
Maco1 A G 4: 134,555,610 (GRCm39) Y288H probably damaging Het
Marf1 T C 16: 13,932,095 (GRCm39) K1641E probably benign Het
Mtfmt T C 9: 65,351,133 (GRCm39) probably benign Het
Mtif3 G A 5: 146,893,598 (GRCm39) T203M probably benign Het
Mycbp2 A G 14: 103,407,430 (GRCm39) I2740T probably benign Het
Nrdc A G 4: 108,903,809 (GRCm39) T720A probably benign Het
Or2d2 T C 7: 106,728,271 (GRCm39) T110A probably benign Het
Peak1 T A 9: 56,148,560 (GRCm39) D32V possibly damaging Het
Pigr G A 1: 130,769,554 (GRCm39) D122N probably benign Het
Plekhg3 A G 12: 76,612,311 (GRCm39) R391G possibly damaging Het
Ppfia3 T C 7: 44,990,542 (GRCm39) D919G probably damaging Het
Pramel23 T A 4: 143,424,939 (GRCm39) Q168L possibly damaging Het
Rnase2b T A 14: 51,400,208 (GRCm39) D96E possibly damaging Het
Rsf1 CGGCGGC CGGCGGCCGCGGCGGC 7: 97,229,130 (GRCm39) probably benign Het
Rsf1 G GACGGCGGCT 7: 97,229,116 (GRCm39) probably benign Het
Serpina3f A G 12: 104,186,615 (GRCm39) T394A probably benign Het
Six3 A G 17: 85,928,720 (GRCm39) N18S possibly damaging Het
Slc12a5 T A 2: 164,825,285 (GRCm39) probably null Het
Slc35f6 A G 5: 30,805,427 (GRCm39) N21S probably damaging Het
Slc39a6 A T 18: 24,729,351 (GRCm39) I454N probably damaging Het
Slc40a1 T A 1: 45,948,824 (GRCm39) E485D probably damaging Het
Sort1 G A 3: 108,235,385 (GRCm39) C255Y probably damaging Het
Stab2 T A 10: 86,785,771 (GRCm39) T624S probably benign Het
Stk33 T A 7: 108,939,605 (GRCm39) I99L probably benign Het
Taf4b T A 18: 15,031,100 (GRCm39) I828N probably damaging Het
Terf2 T C 8: 107,803,110 (GRCm39) probably benign Het
Timd4 C T 11: 46,706,344 (GRCm39) R49C probably damaging Het
Tpte T C 8: 22,808,362 (GRCm39) S166P probably benign Het
Trabd2b T C 4: 114,264,052 (GRCm39) L13P probably benign Het
Trappc11 A T 8: 47,975,476 (GRCm39) Y247* probably null Het
Trnt1 C T 6: 106,755,853 (GRCm39) Q303* probably null Het
Tspyl5 T A 15: 33,687,201 (GRCm39) Q248L possibly damaging Het
Ubxn7 A T 16: 32,200,322 (GRCm39) K337N probably damaging Het
Unc13a T A 8: 72,095,816 (GRCm39) I1234F probably benign Het
Vmn1r127 A T 7: 21,052,943 (GRCm39) F282I probably damaging Het
Wdhd1 A T 14: 47,506,111 (GRCm39) probably null Het
Zfp605 A G 5: 110,275,352 (GRCm39) K157E probably damaging Het
Zhx2 T A 15: 57,684,755 (GRCm39) D41E probably benign Het
Other mutations in Hspa4l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02466:Hspa4l APN 3 40,707,657 (GRCm39) nonsense probably null
IGL02605:Hspa4l APN 3 40,736,055 (GRCm39) missense probably benign 0.20
IGL02719:Hspa4l APN 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R0281:Hspa4l UTSW 3 40,739,840 (GRCm39) splice site probably benign
R0398:Hspa4l UTSW 3 40,711,429 (GRCm39) splice site probably benign
R0487:Hspa4l UTSW 3 40,738,758 (GRCm39) missense possibly damaging 0.87
R0610:Hspa4l UTSW 3 40,733,832 (GRCm39) missense probably benign 0.01
R0760:Hspa4l UTSW 3 40,739,155 (GRCm39) nonsense probably null
R1491:Hspa4l UTSW 3 40,741,226 (GRCm39) missense probably benign 0.00
R1720:Hspa4l UTSW 3 40,736,049 (GRCm39) nonsense probably null
R1984:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R1986:Hspa4l UTSW 3 40,714,833 (GRCm39) missense probably damaging 1.00
R2100:Hspa4l UTSW 3 40,727,090 (GRCm39) missense possibly damaging 0.60
R3706:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3708:Hspa4l UTSW 3 40,736,125 (GRCm39) missense possibly damaging 0.55
R3856:Hspa4l UTSW 3 40,739,821 (GRCm39) missense probably benign 0.29
R3874:Hspa4l UTSW 3 40,727,074 (GRCm39) missense probably damaging 1.00
R3890:Hspa4l UTSW 3 40,736,026 (GRCm39) missense possibly damaging 0.90
R4256:Hspa4l UTSW 3 40,700,435 (GRCm39) missense probably benign 0.03
R4364:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4365:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4366:Hspa4l UTSW 3 40,721,241 (GRCm39) splice site probably null
R4493:Hspa4l UTSW 3 40,722,434 (GRCm39) missense possibly damaging 0.77
R4494:Hspa4l UTSW 3 40,707,636 (GRCm39) missense possibly damaging 0.86
R4954:Hspa4l UTSW 3 40,739,832 (GRCm39) critical splice donor site probably null
R5114:Hspa4l UTSW 3 40,700,197 (GRCm39) missense possibly damaging 0.60
R5133:Hspa4l UTSW 3 40,741,179 (GRCm39) missense possibly damaging 0.94
R5202:Hspa4l UTSW 3 40,736,001 (GRCm39) missense probably benign 0.17
R5440:Hspa4l UTSW 3 40,736,008 (GRCm39) missense probably damaging 1.00
R5635:Hspa4l UTSW 3 40,700,177 (GRCm39) missense probably damaging 1.00
R5997:Hspa4l UTSW 3 40,722,411 (GRCm39) missense probably damaging 0.99
R6012:Hspa4l UTSW 3 40,736,031 (GRCm39) missense probably benign 0.09
R6515:Hspa4l UTSW 3 40,736,014 (GRCm39) missense possibly damaging 0.82
R6589:Hspa4l UTSW 3 40,711,487 (GRCm39) missense probably damaging 0.99
R7091:Hspa4l UTSW 3 40,736,024 (GRCm39) missense probably benign 0.00
R7601:Hspa4l UTSW 3 40,738,788 (GRCm39) critical splice donor site probably null
R8072:Hspa4l UTSW 3 40,741,178 (GRCm39) missense probably damaging 0.98
R9103:Hspa4l UTSW 3 40,715,349 (GRCm39) critical splice donor site probably null
R9146:Hspa4l UTSW 3 40,736,101 (GRCm39) missense probably benign 0.15
R9762:Hspa4l UTSW 3 40,727,057 (GRCm39) missense probably benign 0.01
Z1088:Hspa4l UTSW 3 40,721,425 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CGAACCGCAGTGGAGACTA -3'
(R):5'- GGATAATCCCAGGTCACCCCTC -3'

Sequencing Primer
(F):5'- CAGTGGAGACTAGGCGGC -3'
(R):5'- TAGACGCTGCACCTGTCACAG -3'
Posted On 2016-05-10