Incidental Mutation 'R4994:Lingo4'
ID385078
Institutional Source Beutler Lab
Gene Symbol Lingo4
Ensembl Gene ENSMUSG00000044505
Gene Nameleucine rich repeat and Ig domain containing 4
SynonymsLrrn6d, LERN4, A530050P17Rik
MMRRC Submission 042588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4994 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94398517-94404501 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 94403001 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 415 (H415Q)
Ref Sequence ENSEMBL: ENSMUSP00000058050 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050975] [ENSMUST00000197040]
Predicted Effect probably benign
Transcript: ENSMUST00000050975
AA Change: H415Q

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000058050
Gene: ENSMUSG00000044505
AA Change: H415Q

DomainStartEndE-ValueType
LRRNT 55 89 1.23e-4 SMART
LRR 88 107 2.76e2 SMART
LRR_TYP 108 131 1.02e-6 SMART
LRR_TYP 132 155 7.26e-3 SMART
LRR 156 179 1.33e1 SMART
LRR_TYP 180 203 5.42e-2 SMART
LRR 204 227 4.45e1 SMART
LRR 228 251 3.27e1 SMART
LRR 300 323 4.83e0 SMART
LRR 324 347 3.07e-1 SMART
LRR 348 371 3.36e1 SMART
LRRCT 383 436 5.24e-5 SMART
IGc2 451 516 3.53e-13 SMART
transmembrane domain 560 582 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000197040
SMART Domains Protein: ENSMUSP00000143763
Gene: ENSMUSG00000028150

DomainStartEndE-ValueType
ZnF_C4 7 78 7.2e-37 SMART
low complexity region 95 112 N/A INTRINSIC
HOLI 299 453 3.78e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198829
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C A 9: 94,537,433 R148L probably benign Het
1700030K09Rik A G 8: 72,455,118 E364G probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 A G 5: 8,928,524 T557A probably damaging Het
Acadm C T 3: 153,929,584 E298K probably damaging Het
Adrb3 T C 8: 27,227,827 probably null Het
Aldh1b1 A G 4: 45,803,128 Y222C possibly damaging Het
Ankrd6 A G 4: 32,860,387 Y19H probably damaging Het
Arhgap21 T A 2: 20,849,890 T1554S probably benign Het
BC043934 T C 9: 96,437,120 noncoding transcript Het
Birc6 A G 17: 74,594,324 probably benign Het
Blm A C 7: 80,458,825 F1357C probably benign Het
Cd209a T C 8: 3,747,713 probably null Het
Cdk7 G A 13: 100,717,595 H129Y probably damaging Het
Clec14a G T 12: 58,268,284 P184Q probably damaging Het
Cma1 T A 14: 55,941,671 I243F probably damaging Het
Cntnap3 G T 13: 64,761,984 T769K possibly damaging Het
Col5a1 A C 2: 28,032,739 K273T possibly damaging Het
Csnk1e A G 15: 79,424,929 Y266H probably damaging Het
Cyb5d1 A G 11: 69,393,771 L185S probably damaging Het
Dennd5b T C 6: 149,041,500 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Dzank1 T G 2: 144,522,566 D37A probably damaging Het
Echdc2 A G 4: 108,165,628 I34V probably benign Het
Esm1 A T 13: 113,213,431 R128S probably benign Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fbxo18 T A 2: 11,764,230 I251F probably damaging Het
Fbxo6 A T 4: 148,149,491 S49R probably damaging Het
Gm13089 T A 4: 143,698,369 Q168L possibly damaging Het
Gm17093 A T 14: 44,519,322 Q82L probably damaging Het
Hmcn2 T C 2: 31,458,055 probably null Het
Hspa4l C A 3: 40,745,649 probably benign Het
Il3ra G A 14: 14,351,080 A201T probably benign Het
Irx5 T A 8: 92,360,781 V447E probably damaging Het
Kif14 G T 1: 136,482,959 L668F probably damaging Het
Lag3 T A 6: 124,904,453 R519W unknown Het
Lgr4 A G 2: 110,011,938 N756S probably damaging Het
Lkaaear1 C A 2: 181,697,583 G25* probably null Het
Marf1 T C 16: 14,114,231 K1641E probably benign Het
Mtfmt T C 9: 65,443,851 probably benign Het
Mtif3 G A 5: 146,956,788 T203M probably benign Het
Mycbp2 A G 14: 103,169,994 I2740T probably benign Het
Nrd1 A G 4: 109,046,612 T720A probably benign Het
Olfr715 T C 7: 107,129,064 T110A probably benign Het
Peak1 T A 9: 56,241,276 D32V possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Plekhg3 A G 12: 76,565,537 R391G possibly damaging Het
Ppfia3 T C 7: 45,341,118 D919G probably damaging Het
Rnase2b T A 14: 51,162,751 D96E possibly damaging Het
Rsf1 CGGCGGC CGGCGGCCGCGGCGGC 7: 97,579,923 probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Serpina3f A G 12: 104,220,356 T394A probably benign Het
Six3 A G 17: 85,621,292 N18S possibly damaging Het
Slc12a5 T A 2: 164,983,365 probably null Het
Slc35f6 A G 5: 30,648,083 N21S probably damaging Het
Slc39a6 A T 18: 24,596,294 I454N probably damaging Het
Slc40a1 T A 1: 45,909,664 E485D probably damaging Het
Sort1 G A 3: 108,328,069 C255Y probably damaging Het
Stab2 T A 10: 86,949,907 T624S probably benign Het
Stk33 T A 7: 109,340,398 I99L probably benign Het
Taf4b T A 18: 14,898,043 I828N probably damaging Het
Terf2 T C 8: 107,076,478 probably benign Het
Timd4 C T 11: 46,815,517 R49C probably damaging Het
Tmem57 A G 4: 134,828,299 Y288H probably damaging Het
Tpte T C 8: 22,318,346 S166P probably benign Het
Trabd2b T C 4: 114,406,855 L13P probably benign Het
Trappc11 A T 8: 47,522,441 Y247* probably null Het
Trnt1 C T 6: 106,778,892 Q303* probably null Het
Tspyl5 T A 15: 33,687,055 Q248L possibly damaging Het
Ubxn7 A T 16: 32,381,504 K337N probably damaging Het
Unc13a T A 8: 71,643,172 I1234F probably benign Het
Vmn1r127 A T 7: 21,319,018 F282I probably damaging Het
Wdhd1 A T 14: 47,268,654 probably null Het
Zfp605 A G 5: 110,127,486 K157E probably damaging Het
Zhx2 T A 15: 57,821,359 D41E probably benign Het
Other mutations in Lingo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Lingo4 APN 3 94403288 missense probably benign 0.00
IGL02662:Lingo4 APN 3 94401817 unclassified probably benign
IGL02687:Lingo4 APN 3 94402097 missense probably damaging 1.00
IGL02711:Lingo4 APN 3 94403393 missense probably benign
IGL03001:Lingo4 APN 3 94402396 missense probably damaging 1.00
IGL03260:Lingo4 APN 3 94401943 missense probably benign
PIT4449001:Lingo4 UTSW 3 94401932 missense probably benign
R0088:Lingo4 UTSW 3 94402033 missense probably benign 0.39
R0616:Lingo4 UTSW 3 94403081 missense probably benign 0.00
R1455:Lingo4 UTSW 3 94399392 unclassified probably benign
R1733:Lingo4 UTSW 3 94403178 missense probably benign 0.00
R2001:Lingo4 UTSW 3 94403075 missense probably damaging 1.00
R2085:Lingo4 UTSW 3 94402245 missense probably damaging 1.00
R3793:Lingo4 UTSW 3 94402378 missense probably benign
R3805:Lingo4 UTSW 3 94402100 missense probably damaging 1.00
R3806:Lingo4 UTSW 3 94402100 missense probably damaging 1.00
R4438:Lingo4 UTSW 3 94402897 missense possibly damaging 0.79
R4660:Lingo4 UTSW 3 94403365 missense probably benign 0.00
R4724:Lingo4 UTSW 3 94402876 nonsense probably null
R4981:Lingo4 UTSW 3 94399454 missense probably benign 0.18
R4994:Lingo4 UTSW 3 94402541 missense probably benign
R5600:Lingo4 UTSW 3 94401913 missense probably benign
R6188:Lingo4 UTSW 3 94402850 missense probably damaging 1.00
R6267:Lingo4 UTSW 3 94403390 missense probably benign 0.02
R6303:Lingo4 UTSW 3 94403206 missense probably damaging 1.00
R6304:Lingo4 UTSW 3 94403206 missense probably damaging 1.00
R6789:Lingo4 UTSW 3 94399355 unclassified probably benign
R7313:Lingo4 UTSW 3 94403144 missense possibly damaging 0.95
R7329:Lingo4 UTSW 3 94402855 missense probably benign
X0054:Lingo4 UTSW 3 94403376 missense possibly damaging 0.54
Predicted Primers PCR Primer
(F):5'- ACCTCAATCGCTGCTCATG -3'
(R):5'- TCATCCAGGAAACAGTGGGG -3'

Sequencing Primer
(F):5'- TCCACTTGCTGGATGTAGC -3'
(R):5'- AACAGTGGGGGCTGGGTC -3'
Posted On2016-05-10