Incidental Mutation 'R4994:Sort1'
ID385079
Institutional Source Beutler Lab
Gene Symbol Sort1
Ensembl Gene ENSMUSG00000068747
Gene Namesortilin 1
Synonymssortilin, 2900053A11Rik, Ntsr3, Ntr3, neurotensin receptor 3
MMRRC Submission 042588-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.732) question?
Stock #R4994 (G1)
Quality Score214
Status Validated
Chromosome3
Chromosomal Location108284082-108361511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 108328069 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 255 (C255Y)
Ref Sequence ENSEMBL: ENSMUSP00000123564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102632] [ENSMUST00000135636]
Predicted Effect probably damaging
Transcript: ENSMUST00000102632
AA Change: C255Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099692
Gene: ENSMUSG00000068747
AA Change: C255Y

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 33 47 N/A INTRINSIC
low complexity region 59 79 N/A INTRINSIC
VPS10 131 743 N/A SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135636
AA Change: C255Y

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000123564
Gene: ENSMUSG00000068747
AA Change: C255Y

DomainStartEndE-ValueType
VPS10 1 218 2.3e-5 SMART
transmembrane domain 262 284 N/A INTRINSIC
Meta Mutation Damage Score 0.1642 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the VPS10-related sortilin family of proteins. The encoded preproprotein is proteolytically processed by furin to generate the mature receptor. This receptor plays a role in the trafficking of different proteins to either the cell surface, or subcellular compartments such as lysosomes and endosomes. Expression levels of this gene may influence the risk of myocardial infarction in human patients. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele exhbit increased protection from age- and injury-related neuron lose. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C A 9: 94,537,433 R148L probably benign Het
1700030K09Rik A G 8: 72,455,118 E364G probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 A G 5: 8,928,524 T557A probably damaging Het
Acadm C T 3: 153,929,584 E298K probably damaging Het
Adrb3 T C 8: 27,227,827 probably null Het
Aldh1b1 A G 4: 45,803,128 Y222C possibly damaging Het
Ankrd6 A G 4: 32,860,387 Y19H probably damaging Het
Arhgap21 T A 2: 20,849,890 T1554S probably benign Het
BC043934 T C 9: 96,437,120 noncoding transcript Het
Birc6 A G 17: 74,594,324 probably benign Het
Blm A C 7: 80,458,825 F1357C probably benign Het
Cd209a T C 8: 3,747,713 probably null Het
Cdk7 G A 13: 100,717,595 H129Y probably damaging Het
Clec14a G T 12: 58,268,284 P184Q probably damaging Het
Cma1 T A 14: 55,941,671 I243F probably damaging Het
Cntnap3 G T 13: 64,761,984 T769K possibly damaging Het
Col5a1 A C 2: 28,032,739 K273T possibly damaging Het
Csnk1e A G 15: 79,424,929 Y266H probably damaging Het
Cyb5d1 A G 11: 69,393,771 L185S probably damaging Het
Dennd5b T C 6: 149,041,500 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Dzank1 T G 2: 144,522,566 D37A probably damaging Het
Echdc2 A G 4: 108,165,628 I34V probably benign Het
Esm1 A T 13: 113,213,431 R128S probably benign Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fbxo18 T A 2: 11,764,230 I251F probably damaging Het
Fbxo6 A T 4: 148,149,491 S49R probably damaging Het
Gm13089 T A 4: 143,698,369 Q168L possibly damaging Het
Gm17093 A T 14: 44,519,322 Q82L probably damaging Het
Hmcn2 T C 2: 31,458,055 probably null Het
Hspa4l C A 3: 40,745,649 probably benign Het
Il3ra G A 14: 14,351,080 A201T probably benign Het
Irx5 T A 8: 92,360,781 V447E probably damaging Het
Kif14 G T 1: 136,482,959 L668F probably damaging Het
Lag3 T A 6: 124,904,453 R519W unknown Het
Lgr4 A G 2: 110,011,938 N756S probably damaging Het
Lingo4 A G 3: 94,402,541 H262R probably benign Het
Lingo4 T A 3: 94,403,001 H415Q probably benign Het
Lkaaear1 C A 2: 181,697,583 G25* probably null Het
Marf1 T C 16: 14,114,231 K1641E probably benign Het
Mtfmt T C 9: 65,443,851 probably benign Het
Mtif3 G A 5: 146,956,788 T203M probably benign Het
Mycbp2 A G 14: 103,169,994 I2740T probably benign Het
Nrd1 A G 4: 109,046,612 T720A probably benign Het
Olfr715 T C 7: 107,129,064 T110A probably benign Het
Peak1 T A 9: 56,241,276 D32V possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Plekhg3 A G 12: 76,565,537 R391G possibly damaging Het
Ppfia3 T C 7: 45,341,118 D919G probably damaging Het
Rnase2b T A 14: 51,162,751 D96E possibly damaging Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Rsf1 CGGCGGC CGGCGGCCGCGGCGGC 7: 97,579,923 probably benign Het
Serpina3f A G 12: 104,220,356 T394A probably benign Het
Six3 A G 17: 85,621,292 N18S possibly damaging Het
Slc12a5 T A 2: 164,983,365 probably null Het
Slc35f6 A G 5: 30,648,083 N21S probably damaging Het
Slc39a6 A T 18: 24,596,294 I454N probably damaging Het
Slc40a1 T A 1: 45,909,664 E485D probably damaging Het
Stab2 T A 10: 86,949,907 T624S probably benign Het
Stk33 T A 7: 109,340,398 I99L probably benign Het
Taf4b T A 18: 14,898,043 I828N probably damaging Het
Terf2 T C 8: 107,076,478 probably benign Het
Timd4 C T 11: 46,815,517 R49C probably damaging Het
Tmem57 A G 4: 134,828,299 Y288H probably damaging Het
Tpte T C 8: 22,318,346 S166P probably benign Het
Trabd2b T C 4: 114,406,855 L13P probably benign Het
Trappc11 A T 8: 47,522,441 Y247* probably null Het
Trnt1 C T 6: 106,778,892 Q303* probably null Het
Tspyl5 T A 15: 33,687,055 Q248L possibly damaging Het
Ubxn7 A T 16: 32,381,504 K337N probably damaging Het
Unc13a T A 8: 71,643,172 I1234F probably benign Het
Vmn1r127 A T 7: 21,319,018 F282I probably damaging Het
Wdhd1 A T 14: 47,268,654 probably null Het
Zfp605 A G 5: 110,127,486 K157E probably damaging Het
Zhx2 T A 15: 57,821,359 D41E probably benign Het
Other mutations in Sort1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Sort1 APN 3 108356307 missense probably damaging 0.99
IGL01677:Sort1 APN 3 108344885 missense probably benign 0.05
IGL02532:Sort1 APN 3 108325720 missense probably benign 0.44
IGL03354:Sort1 APN 3 108348706 missense probably benign 0.00
R0266:Sort1 UTSW 3 108344931 missense probably benign 0.09
R0277:Sort1 UTSW 3 108324592 splice site probably benign
R0559:Sort1 UTSW 3 108356579 missense probably damaging 1.00
R0597:Sort1 UTSW 3 108338910 missense probably damaging 1.00
R0624:Sort1 UTSW 3 108348630 missense probably damaging 1.00
R1803:Sort1 UTSW 3 108325699 missense probably damaging 1.00
R1872:Sort1 UTSW 3 108340695 missense probably benign 0.01
R1986:Sort1 UTSW 3 108345727 missense possibly damaging 0.71
R2130:Sort1 UTSW 3 108351686 missense probably benign
R2131:Sort1 UTSW 3 108351686 missense probably benign
R2133:Sort1 UTSW 3 108351686 missense probably benign
R2362:Sort1 UTSW 3 108346665 missense possibly damaging 0.89
R3436:Sort1 UTSW 3 108337807 missense probably damaging 1.00
R3548:Sort1 UTSW 3 108337909 missense possibly damaging 0.83
R3700:Sort1 UTSW 3 108356639 nonsense probably null
R4496:Sort1 UTSW 3 108310145 missense probably benign 0.17
R4616:Sort1 UTSW 3 108355541 missense possibly damaging 0.66
R4632:Sort1 UTSW 3 108346678 missense probably damaging 1.00
R4749:Sort1 UTSW 3 108356323 nonsense probably null
R5187:Sort1 UTSW 3 108324676 missense probably damaging 1.00
R5753:Sort1 UTSW 3 108345774 missense probably damaging 1.00
R6019:Sort1 UTSW 3 108357233 missense possibly damaging 0.77
R6262:Sort1 UTSW 3 108310211 missense probably damaging 1.00
R7369:Sort1 UTSW 3 108351680 missense probably damaging 1.00
R7484:Sort1 UTSW 3 108338825 missense probably damaging 1.00
R7512:Sort1 UTSW 3 108326007 intron probably null
Z1177:Sort1 UTSW 3 108284380 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCGAGTAATCTGTGTGCATGC -3'
(R):5'- GCCCTTGCAACATTCACTG -3'

Sequencing Primer
(F):5'- ATGTGTGTACATGCATGCAC -3'
(R):5'- CACTGAGACAAAGTCTTTTTCCAG -3'
Posted On2016-05-10