Incidental Mutation 'R4994:Aldh1b1'
List |< first << previous [record 7 of 77] next >> last >|
ID385082
Institutional Source Beutler Lab
Gene Symbol Aldh1b1
Ensembl Gene ENSMUSG00000035561
Gene Namealdehyde dehydrogenase 1 family, member B1
Synonyms
MMRRC Submission 042588-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4994 (G1)
Quality Score154
Status Validated
Chromosome4
Chromosomal Location45799022-45804604 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 45803128 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 222 (Y222C)
Ref Sequence ENSEMBL: ENSMUSP00000041260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044384] [ENSMUST00000172750]
Predicted Effect possibly damaging
Transcript: ENSMUST00000044384
AA Change: Y222C

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041260
Gene: ENSMUSG00000035561
AA Change: Y222C

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Aldedh 47 510 1.5e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172750
SMART Domains Protein: ENSMUSP00000134082
Gene: ENSMUSG00000035561

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:Aldedh 47 132 1.4e-23 PFAM
Meta Mutation Damage Score 0.5335 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenases family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. This gene does not contain introns in the coding sequence. The variation of this locus may affect the development of alcohol-related problems. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased fasting circulating glucose levels and decreased blood acetaldehyde clearance. Mice homozygous for a different knock-out allele display defects in beta cell development and functionality, and develop glucose intolerance, age-dependent hyperglycemia, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C A 9: 94,537,433 R148L probably benign Het
1700030K09Rik A G 8: 72,455,118 E364G probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 A G 5: 8,928,524 T557A probably damaging Het
Acadm C T 3: 153,929,584 E298K probably damaging Het
Adrb3 T C 8: 27,227,827 probably null Het
Ankrd6 A G 4: 32,860,387 Y19H probably damaging Het
Arhgap21 T A 2: 20,849,890 T1554S probably benign Het
BC043934 T C 9: 96,437,120 noncoding transcript Het
Birc6 A G 17: 74,594,324 probably benign Het
Blm A C 7: 80,458,825 F1357C probably benign Het
Cd209a T C 8: 3,747,713 probably null Het
Cdk7 G A 13: 100,717,595 H129Y probably damaging Het
Clec14a G T 12: 58,268,284 P184Q probably damaging Het
Cma1 T A 14: 55,941,671 I243F probably damaging Het
Cntnap3 G T 13: 64,761,984 T769K possibly damaging Het
Col5a1 A C 2: 28,032,739 K273T possibly damaging Het
Csnk1e A G 15: 79,424,929 Y266H probably damaging Het
Cyb5d1 A G 11: 69,393,771 L185S probably damaging Het
Dennd5b T C 6: 149,041,500 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Dzank1 T G 2: 144,522,566 D37A probably damaging Het
Echdc2 A G 4: 108,165,628 I34V probably benign Het
Esm1 A T 13: 113,213,431 R128S probably benign Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fbxo18 T A 2: 11,764,230 I251F probably damaging Het
Fbxo6 A T 4: 148,149,491 S49R probably damaging Het
Gm13089 T A 4: 143,698,369 Q168L possibly damaging Het
Gm17093 A T 14: 44,519,322 Q82L probably damaging Het
Hmcn2 T C 2: 31,458,055 probably null Het
Hspa4l C A 3: 40,745,649 probably benign Het
Il3ra G A 14: 14,351,080 A201T probably benign Het
Irx5 T A 8: 92,360,781 V447E probably damaging Het
Kif14 G T 1: 136,482,959 L668F probably damaging Het
Lag3 T A 6: 124,904,453 R519W unknown Het
Lgr4 A G 2: 110,011,938 N756S probably damaging Het
Lingo4 A G 3: 94,402,541 H262R probably benign Het
Lingo4 T A 3: 94,403,001 H415Q probably benign Het
Lkaaear1 C A 2: 181,697,583 G25* probably null Het
Marf1 T C 16: 14,114,231 K1641E probably benign Het
Mtfmt T C 9: 65,443,851 probably benign Het
Mtif3 G A 5: 146,956,788 T203M probably benign Het
Mycbp2 A G 14: 103,169,994 I2740T probably benign Het
Nrd1 A G 4: 109,046,612 T720A probably benign Het
Olfr715 T C 7: 107,129,064 T110A probably benign Het
Peak1 T A 9: 56,241,276 D32V possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Plekhg3 A G 12: 76,565,537 R391G possibly damaging Het
Ppfia3 T C 7: 45,341,118 D919G probably damaging Het
Rnase2b T A 14: 51,162,751 D96E possibly damaging Het
Rsf1 CGGCGGC CGGCGGCCGCGGCGGC 7: 97,579,923 probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Serpina3f A G 12: 104,220,356 T394A probably benign Het
Six3 A G 17: 85,621,292 N18S possibly damaging Het
Slc12a5 T A 2: 164,983,365 probably null Het
Slc35f6 A G 5: 30,648,083 N21S probably damaging Het
Slc39a6 A T 18: 24,596,294 I454N probably damaging Het
Slc40a1 T A 1: 45,909,664 E485D probably damaging Het
Sort1 G A 3: 108,328,069 C255Y probably damaging Het
Stab2 T A 10: 86,949,907 T624S probably benign Het
Stk33 T A 7: 109,340,398 I99L probably benign Het
Taf4b T A 18: 14,898,043 I828N probably damaging Het
Terf2 T C 8: 107,076,478 probably benign Het
Timd4 C T 11: 46,815,517 R49C probably damaging Het
Tmem57 A G 4: 134,828,299 Y288H probably damaging Het
Tpte T C 8: 22,318,346 S166P probably benign Het
Trabd2b T C 4: 114,406,855 L13P probably benign Het
Trappc11 A T 8: 47,522,441 Y247* probably null Het
Trnt1 C T 6: 106,778,892 Q303* probably null Het
Tspyl5 T A 15: 33,687,055 Q248L possibly damaging Het
Ubxn7 A T 16: 32,381,504 K337N probably damaging Het
Unc13a T A 8: 71,643,172 I1234F probably benign Het
Vmn1r127 A T 7: 21,319,018 F282I probably damaging Het
Wdhd1 A T 14: 47,268,654 probably null Het
Zfp605 A G 5: 110,127,486 K157E probably damaging Het
Zhx2 T A 15: 57,821,359 D41E probably benign Het
Other mutations in Aldh1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01731:Aldh1b1 APN 4 45803472 missense possibly damaging 0.87
R0557:Aldh1b1 UTSW 4 45802647 missense probably benign 0.00
R1203:Aldh1b1 UTSW 4 45803359 missense probably damaging 1.00
R1807:Aldh1b1 UTSW 4 45802873 missense possibly damaging 0.69
R1939:Aldh1b1 UTSW 4 45802755 missense possibly damaging 0.53
R4722:Aldh1b1 UTSW 4 45803472 missense probably damaging 1.00
R4847:Aldh1b1 UTSW 4 45802625 missense possibly damaging 0.92
R4871:Aldh1b1 UTSW 4 45803383 missense probably benign 0.00
R4931:Aldh1b1 UTSW 4 45803661 missense probably benign 0.08
R5071:Aldh1b1 UTSW 4 45803383 unclassified probably null
R5216:Aldh1b1 UTSW 4 45803652 missense probably damaging 1.00
R5582:Aldh1b1 UTSW 4 45802750 missense probably damaging 1.00
R6077:Aldh1b1 UTSW 4 45802525 missense possibly damaging 0.92
R6640:Aldh1b1 UTSW 4 45803868 missense possibly damaging 0.92
R6692:Aldh1b1 UTSW 4 45803427 missense probably damaging 1.00
R7055:Aldh1b1 UTSW 4 45802909 missense possibly damaging 0.84
Z1088:Aldh1b1 UTSW 4 45802539 missense probably benign 0.06
Z1088:Aldh1b1 UTSW 4 45802540 missense probably benign 0.11
Z1177:Aldh1b1 UTSW 4 45802692 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTGTACCGTTACTTCGC -3'
(R):5'- TCTTGAGGTTAGACTCGCCAG -3'

Sequencing Primer
(F):5'- ACCGTTACTTCGCTGGCTGG -3'
(R):5'- AGCTGCCTTCTGAATCAGG -3'
Posted On2016-05-10