Incidental Mutation 'R4994:Echdc2'
ID385083
Institutional Source Beutler Lab
Gene Symbol Echdc2
Ensembl Gene ENSMUSG00000028601
Gene Nameenoyl Coenzyme A hydratase domain containing 2
Synonyms1300017C12Rik, 2610009M20Rik
MMRRC Submission 042588-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R4994 (G1)
Quality Score213
Status Validated
Chromosome4
Chromosomal Location108165437-108179308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 108165628 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 34 (I34V)
Ref Sequence ENSEMBL: ENSMUSP00000124746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052999] [ENSMUST00000116307] [ENSMUST00000116309] [ENSMUST00000125647] [ENSMUST00000130942]
Predicted Effect probably benign
Transcript: ENSMUST00000052999
AA Change: I34V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000051268
Gene: ENSMUSG00000028601
AA Change: I34V

DomainStartEndE-ValueType
Pfam:ECH_1 41 296 1.1e-60 PFAM
Pfam:ECH_2 46 225 5.1e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116307
AA Change: I34V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112009
Gene: ENSMUSG00000028601
AA Change: I34V

DomainStartEndE-ValueType
Pfam:ECH 39 131 6.7e-17 PFAM
Pfam:ECH 124 257 5.3e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116309
AA Change: I34V

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112011
Gene: ENSMUSG00000028601
AA Change: I34V

DomainStartEndE-ValueType
Pfam:ECH 39 288 3.2e-61 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123280
Predicted Effect unknown
Transcript: ENSMUST00000125647
AA Change: I34V
SMART Domains Protein: ENSMUSP00000123913
Gene: ENSMUSG00000028601
AA Change: I34V

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130942
AA Change: I34V

PolyPhen 2 Score 0.206 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124746
Gene: ENSMUSG00000028601
AA Change: I34V

DomainStartEndE-ValueType
Pfam:ECH 39 103 8.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133049
Predicted Effect probably benign
Transcript: ENSMUST00000135718
SMART Domains Protein: ENSMUSP00000114371
Gene: ENSMUSG00000028601

DomainStartEndE-ValueType
Pfam:ECH_1 1 74 9.6e-16 PFAM
Pfam:ECH_2 2 74 1.1e-11 PFAM
Pfam:ECH_1 69 184 2.8e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138701
Meta Mutation Damage Score 0.0600 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (79/79)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C A 9: 94,537,433 R148L probably benign Het
1700030K09Rik A G 8: 72,455,118 E364G probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 A G 5: 8,928,524 T557A probably damaging Het
Acadm C T 3: 153,929,584 E298K probably damaging Het
Adrb3 T C 8: 27,227,827 probably null Het
Aldh1b1 A G 4: 45,803,128 Y222C possibly damaging Het
Ankrd6 A G 4: 32,860,387 Y19H probably damaging Het
Arhgap21 T A 2: 20,849,890 T1554S probably benign Het
BC043934 T C 9: 96,437,120 noncoding transcript Het
Birc6 A G 17: 74,594,324 probably benign Het
Blm A C 7: 80,458,825 F1357C probably benign Het
Cd209a T C 8: 3,747,713 probably null Het
Cdk7 G A 13: 100,717,595 H129Y probably damaging Het
Clec14a G T 12: 58,268,284 P184Q probably damaging Het
Cma1 T A 14: 55,941,671 I243F probably damaging Het
Cntnap3 G T 13: 64,761,984 T769K possibly damaging Het
Col5a1 A C 2: 28,032,739 K273T possibly damaging Het
Csnk1e A G 15: 79,424,929 Y266H probably damaging Het
Cyb5d1 A G 11: 69,393,771 L185S probably damaging Het
Dennd5b T C 6: 149,041,500 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Dzank1 T G 2: 144,522,566 D37A probably damaging Het
Esm1 A T 13: 113,213,431 R128S probably benign Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fbxo18 T A 2: 11,764,230 I251F probably damaging Het
Fbxo6 A T 4: 148,149,491 S49R probably damaging Het
Gm13089 T A 4: 143,698,369 Q168L possibly damaging Het
Gm17093 A T 14: 44,519,322 Q82L probably damaging Het
Hmcn2 T C 2: 31,458,055 probably null Het
Hspa4l C A 3: 40,745,649 probably benign Het
Il3ra G A 14: 14,351,080 A201T probably benign Het
Irx5 T A 8: 92,360,781 V447E probably damaging Het
Kif14 G T 1: 136,482,959 L668F probably damaging Het
Lag3 T A 6: 124,904,453 R519W unknown Het
Lgr4 A G 2: 110,011,938 N756S probably damaging Het
Lingo4 A G 3: 94,402,541 H262R probably benign Het
Lingo4 T A 3: 94,403,001 H415Q probably benign Het
Lkaaear1 C A 2: 181,697,583 G25* probably null Het
Marf1 T C 16: 14,114,231 K1641E probably benign Het
Mtfmt T C 9: 65,443,851 probably benign Het
Mtif3 G A 5: 146,956,788 T203M probably benign Het
Mycbp2 A G 14: 103,169,994 I2740T probably benign Het
Nrd1 A G 4: 109,046,612 T720A probably benign Het
Olfr715 T C 7: 107,129,064 T110A probably benign Het
Peak1 T A 9: 56,241,276 D32V possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Plekhg3 A G 12: 76,565,537 R391G possibly damaging Het
Ppfia3 T C 7: 45,341,118 D919G probably damaging Het
Rnase2b T A 14: 51,162,751 D96E possibly damaging Het
Rsf1 CGGCGGC CGGCGGCCGCGGCGGC 7: 97,579,923 probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Serpina3f A G 12: 104,220,356 T394A probably benign Het
Six3 A G 17: 85,621,292 N18S possibly damaging Het
Slc12a5 T A 2: 164,983,365 probably null Het
Slc35f6 A G 5: 30,648,083 N21S probably damaging Het
Slc39a6 A T 18: 24,596,294 I454N probably damaging Het
Slc40a1 T A 1: 45,909,664 E485D probably damaging Het
Sort1 G A 3: 108,328,069 C255Y probably damaging Het
Stab2 T A 10: 86,949,907 T624S probably benign Het
Stk33 T A 7: 109,340,398 I99L probably benign Het
Taf4b T A 18: 14,898,043 I828N probably damaging Het
Terf2 T C 8: 107,076,478 probably benign Het
Timd4 C T 11: 46,815,517 R49C probably damaging Het
Tmem57 A G 4: 134,828,299 Y288H probably damaging Het
Tpte T C 8: 22,318,346 S166P probably benign Het
Trabd2b T C 4: 114,406,855 L13P probably benign Het
Trappc11 A T 8: 47,522,441 Y247* probably null Het
Trnt1 C T 6: 106,778,892 Q303* probably null Het
Tspyl5 T A 15: 33,687,055 Q248L possibly damaging Het
Ubxn7 A T 16: 32,381,504 K337N probably damaging Het
Unc13a T A 8: 71,643,172 I1234F probably benign Het
Vmn1r127 A T 7: 21,319,018 F282I probably damaging Het
Wdhd1 A T 14: 47,268,654 probably null Het
Zfp605 A G 5: 110,127,486 K157E probably damaging Het
Zhx2 T A 15: 57,821,359 D41E probably benign Het
Other mutations in Echdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Echdc2 APN 4 108178911 missense probably damaging 1.00
IGL03122:Echdc2 APN 4 108165580 missense probably benign 0.00
IGL03201:Echdc2 APN 4 108169870 missense possibly damaging 0.87
R1579:Echdc2 UTSW 4 108173809 missense probably benign 0.01
R1836:Echdc2 UTSW 4 108165535 missense probably damaging 0.99
R5010:Echdc2 UTSW 4 108172131 missense probably benign 0.00
R5111:Echdc2 UTSW 4 108169797 splice site probably benign
R5880:Echdc2 UTSW 4 108172900 missense possibly damaging 0.87
R7175:Echdc2 UTSW 4 108174169 missense probably damaging 1.00
R7699:Echdc2 UTSW 4 108174077 missense probably benign
R7700:Echdc2 UTSW 4 108174077 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGGAACTACGATTTTCCAGC -3'
(R):5'- GAAAAGTCCTGGCTAGCACTG -3'

Sequencing Primer
(F):5'- ATTTTCCAGCTCTGCCGAGGAG -3'
(R):5'- AAGTCCTGGCTAGCACTGTTGTC -3'
Posted On2016-05-10