Mutagenetix > Incidental Mutation

Incidental Mutation 'R4994:Abcb4'

385088

Institutional Source

Beutler Lab

Gene Symbol

Abcb4

Ensembl Gene

ENSMUSG00000042476

Gene Name

ATP-binding cassette, sub-family B (MDR/TAP), member 4

Synonyms

Pgy-2, Mdr2, Pgy2, mdr-2

MMRRC Submission

042588-MU

Accession Numbers

Ncbi RefSeq: NM_008830; MGI: 97569

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4994 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

8893717-8959231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 8928524 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 557 (T557A)

Ref Sequence

ENSEMBL: ENSMUSP00000142425 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003717] [ENSMUST00000196067]

AlphaFold

P21440

Predicted Effect

probably damaging
Transcript: ENSMUST00000003717
AA Change: T557A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000003717
Gene: ENSMUSG00000042476
AA Change: T557A

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	54	342	2e-94	PFAM
AAA	418	610	3.97e-20	SMART
Pfam:ABC_membrane	708	982	6.3e-77	PFAM
AAA	1058	1246	4.49e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000196067
AA Change: T557A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142425
Gene: ENSMUSG00000042476
AA Change: T557A

Domain	Start	End	E-Value	Type
Pfam:ABC_membrane	54	344	2.4e-95	PFAM
AAA	418	610	6.2e-22	SMART
Pfam:ABC_membrane	708	882	1.6e-37	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000199954

Meta Mutation Damage Score

0.8404

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

Strain: 1857236
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a full transporter and member of the p-glycoprotein family of membrane proteins with phosphatidylcholine as its substrate. The function of this protein has not yet been determined; however, it may involve transport of phospholipids from liver hepatocytes into bile. Alternative splicing of this gene results in several products of undetermined function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene are unable to secrete phospholipids into bile, leading to progressive hepatic disease, with an end stage of 3 months. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	C	A	9: 94,537,433	R148L	probably benign	Het
1700030K09Rik	A	G	8: 72,455,118	E364G	probably benign	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Acadm	C	T	3: 153,929,584	E298K	probably damaging	Het
Adrb3	T	C	8: 27,227,827		probably null	Het
Aldh1b1	A	G	4: 45,803,128	Y222C	possibly damaging	Het
Ankrd6	A	G	4: 32,860,387	Y19H	probably damaging	Het
Arhgap21	T	A	2: 20,849,890	T1554S	probably benign	Het
BC043934	T	C	9: 96,437,120		noncoding transcript	Het
Birc6	A	G	17: 74,594,324		probably benign	Het
Blm	A	C	7: 80,458,825	F1357C	probably benign	Het
Cd209a	T	C	8: 3,747,713		probably null	Het
Cdk7	G	A	13: 100,717,595	H129Y	probably damaging	Het
Clec14a	G	T	12: 58,268,284	P184Q	probably damaging	Het
Cma1	T	A	14: 55,941,671	I243F	probably damaging	Het
Cntnap3	G	T	13: 64,761,984	T769K	possibly damaging	Het
Col5a1	A	C	2: 28,032,739	K273T	possibly damaging	Het
Csnk1e	A	G	15: 79,424,929	Y266H	probably damaging	Het
Cyb5d1	A	G	11: 69,393,771	L185S	probably damaging	Het
Dennd5b	T	C	6: 149,041,500		probably null	Het
Drp2	G	A	X: 134,441,316	R567H	probably damaging	Homo
Dzank1	T	G	2: 144,522,566	D37A	probably damaging	Het
Echdc2	A	G	4: 108,165,628	I34V	probably benign	Het
Esm1	A	T	13: 113,213,431	R128S	probably benign	Het
Fbrsl1	A	G	5: 110,447,951	S73P	probably damaging	Het
Fbxo18	T	A	2: 11,764,230	I251F	probably damaging	Het
Fbxo6	A	T	4: 148,149,491	S49R	probably damaging	Het
Gm13089	T	A	4: 143,698,369	Q168L	possibly damaging	Het
Gm17093	A	T	14: 44,519,322	Q82L	probably damaging	Het
Hmcn2	T	C	2: 31,458,055		probably null	Het
Hspa4l	C	A	3: 40,745,649		probably benign	Het
Il3ra	G	A	14: 14,351,080	A201T	probably benign	Het
Irx5	T	A	8: 92,360,781	V447E	probably damaging	Het
Kif14	G	T	1: 136,482,959	L668F	probably damaging	Het
Lag3	T	A	6: 124,904,453	R519W	unknown	Het
Lgr4	A	G	2: 110,011,938	N756S	probably damaging	Het
Lingo4	A	G	3: 94,402,541	H262R	probably benign	Het
Lingo4	T	A	3: 94,403,001	H415Q	probably benign	Het
Lkaaear1	C	A	2: 181,697,583	G25*	probably null	Het
Marf1	T	C	16: 14,114,231	K1641E	probably benign	Het
Mtfmt	T	C	9: 65,443,851		probably benign	Het
Mtif3	G	A	5: 146,956,788	T203M	probably benign	Het
Mycbp2	A	G	14: 103,169,994	I2740T	probably benign	Het
Nrd1	A	G	4: 109,046,612	T720A	probably benign	Het
Olfr715	T	C	7: 107,129,064	T110A	probably benign	Het
Peak1	T	A	9: 56,241,276	D32V	possibly damaging	Het
Pigr	G	A	1: 130,841,817	D122N	probably benign	Het
Plekhg3	A	G	12: 76,565,537	R391G	possibly damaging	Het
Ppfia3	T	C	7: 45,341,118	D919G	probably damaging	Het
Rnase2b	T	A	14: 51,162,751	D96E	possibly damaging	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Rsf1	CGGCGGC	CGGCGGCCGCGGCGGC	7: 97,579,923		probably benign	Het
Serpina3f	A	G	12: 104,220,356	T394A	probably benign	Het
Six3	A	G	17: 85,621,292	N18S	possibly damaging	Het
Slc12a5	T	A	2: 164,983,365		probably null	Het
Slc35f6	A	G	5: 30,648,083	N21S	probably damaging	Het
Slc39a6	A	T	18: 24,596,294	I454N	probably damaging	Het
Slc40a1	T	A	1: 45,909,664	E485D	probably damaging	Het
Sort1	G	A	3: 108,328,069	C255Y	probably damaging	Het
Stab2	T	A	10: 86,949,907	T624S	probably benign	Het
Stk33	T	A	7: 109,340,398	I99L	probably benign	Het
Taf4b	T	A	18: 14,898,043	I828N	probably damaging	Het
Terf2	T	C	8: 107,076,478		probably benign	Het
Timd4	C	T	11: 46,815,517	R49C	probably damaging	Het
Tmem57	A	G	4: 134,828,299	Y288H	probably damaging	Het
Tpte	T	C	8: 22,318,346	S166P	probably benign	Het
Trabd2b	T	C	4: 114,406,855	L13P	probably benign	Het
Trappc11	A	T	8: 47,522,441	Y247*	probably null	Het
Trnt1	C	T	6: 106,778,892	Q303*	probably null	Het
Tspyl5	T	A	15: 33,687,055	Q248L	possibly damaging	Het
Ubxn7	A	T	16: 32,381,504	K337N	probably damaging	Het
Unc13a	T	A	8: 71,643,172	I1234F	probably benign	Het
Vmn1r127	A	T	7: 21,319,018	F282I	probably damaging	Het
Wdhd1	A	T	14: 47,268,654		probably null	Het
Zfp605	A	G	5: 110,127,486	K157E	probably damaging	Het
Zhx2	T	A	15: 57,821,359	D41E	probably benign	Het

Other mutations in Abcb4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00570:Abcb4	APN	5	8950073	missense	probably benign	0.02
IGL00663:Abcb4	APN	5	8927916	missense	probably damaging	1.00
IGL00671:Abcb4	APN	5	8930745	nonsense	probably null
IGL00822:Abcb4	APN	5	8950046	missense	probably benign
IGL01080:Abcb4	APN	5	8934258	missense	probably damaging	1.00
IGL01152:Abcb4	APN	5	8950678	missense	probably benign	0.19
IGL01329:Abcb4	APN	5	8894166	critical splice donor site	probably null
IGL01483:Abcb4	APN	5	8927871	missense	probably damaging	0.99
IGL01594:Abcb4	APN	5	8946071	splice site	probably null
IGL01785:Abcb4	APN	5	8915058	nonsense	probably null
IGL01968:Abcb4	APN	5	8927913	missense	probably benign	0.33
IGL02579:Abcb4	APN	5	8955537	missense	probably damaging	1.00
IGL02654:Abcb4	APN	5	8927826	missense	possibly damaging	0.80
IGL02658:Abcb4	APN	5	8934240	missense	probably benign
IGL03229:Abcb4	APN	5	8940936	missense	probably damaging	0.97
IGL03335:Abcb4	APN	5	8935258	missense	probably benign	0.00
FR4737:Abcb4	UTSW	5	8896597	small deletion	probably benign
P0014:Abcb4	UTSW	5	8950083	missense	probably benign	0.01
R0102:Abcb4	UTSW	5	8909194	missense	probably damaging	0.99
R0102:Abcb4	UTSW	5	8909194	missense	probably damaging	0.99
R0309:Abcb4	UTSW	5	8939835	missense	probably damaging	1.00
R0311:Abcb4	UTSW	5	8934243	missense	probably benign
R0420:Abcb4	UTSW	5	8941050	missense	probably benign	0.03
R0449:Abcb4	UTSW	5	8939885	nonsense	probably null
R0609:Abcb4	UTSW	5	8947376	missense	probably damaging	0.96
R1459:Abcb4	UTSW	5	8918662	missense	possibly damaging	0.61
R1470:Abcb4	UTSW	5	8940968	missense	probably damaging	0.98
R1470:Abcb4	UTSW	5	8940968	missense	probably damaging	0.98
R1812:Abcb4	UTSW	5	8928578	critical splice donor site	probably null
R1944:Abcb4	UTSW	5	8930796	missense	probably damaging	1.00
R2002:Abcb4	UTSW	5	8905989	missense	probably benign	0.01
R2256:Abcb4	UTSW	5	8958431	missense	probably damaging	1.00
R3116:Abcb4	UTSW	5	8896610	missense	possibly damaging	0.86
R4112:Abcb4	UTSW	5	8936783	critical splice acceptor site	probably null
R4354:Abcb4	UTSW	5	8918771	missense	probably benign	0.44
R4512:Abcb4	UTSW	5	8928573	missense	probably damaging	1.00
R4588:Abcb4	UTSW	5	8947328	missense	probably benign	0.01
R4628:Abcb4	UTSW	5	8907399	missense	probably benign	0.08
R4708:Abcb4	UTSW	5	8915125	missense	possibly damaging	0.90
R4714:Abcb4	UTSW	5	8930906	splice site	probably null
R4754:Abcb4	UTSW	5	8910717	missense	probably damaging	1.00
R4846:Abcb4	UTSW	5	8935180	missense	probably benign
R4896:Abcb4	UTSW	5	8907267	missense	possibly damaging	0.81
R4944:Abcb4	UTSW	5	8934327	critical splice donor site	probably null
R5022:Abcb4	UTSW	5	8909054	splice site	probably null
R5537:Abcb4	UTSW	5	8955485	missense	probably damaging	0.98
R5754:Abcb4	UTSW	5	8934320	missense	probably benign
R5833:Abcb4	UTSW	5	8958314	missense	probably damaging	1.00
R5934:Abcb4	UTSW	5	8930806	missense	probably benign	0.18
R6006:Abcb4	UTSW	5	8946026	missense	probably damaging	0.99
R6146:Abcb4	UTSW	5	8896587	missense	probably benign	0.05
R6183:Abcb4	UTSW	5	8918718	missense	probably benign
R6260:Abcb4	UTSW	5	8934219	nonsense	probably null
R6561:Abcb4	UTSW	5	8927825	missense	probably benign	0.14
R7016:Abcb4	UTSW	5	8936843	missense	probably benign	0.35
R7081:Abcb4	UTSW	5	8934263	missense	probably benign
R7326:Abcb4	UTSW	5	8934226	missense	probably benign	0.00
R7375:Abcb4	UTSW	5	8918671	missense	probably benign
R7787:Abcb4	UTSW	5	8909220	missense	probably damaging	1.00
R7836:Abcb4	UTSW	5	8934203	missense	probably benign
R8128:Abcb4	UTSW	5	8958395	missense	probably damaging	1.00
R8350:Abcb4	UTSW	5	8928578	critical splice donor site	probably null
R8438:Abcb4	UTSW	5	8946120	critical splice donor site	probably null
R8447:Abcb4	UTSW	5	8907278	missense	probably damaging	0.97
R8710:Abcb4	UTSW	5	8955495	missense	probably damaging	1.00
R8777:Abcb4	UTSW	5	8939894	missense	probably benign	0.01
R8777-TAIL:Abcb4	UTSW	5	8939894	missense	probably benign	0.01
R8837:Abcb4	UTSW	5	8936873	missense	probably damaging	0.99
R8987:Abcb4	UTSW	5	8927931	missense	probably benign	0.02
R9098:Abcb4	UTSW	5	8958441	missense	probably damaging	1.00
R9167:Abcb4	UTSW	5	8936849	nonsense	probably null
R9210:Abcb4	UTSW	5	8955591	missense	probably damaging	1.00
R9212:Abcb4	UTSW	5	8955591	missense	probably damaging	1.00
R9218:Abcb4	UTSW	5	8927960	missense	probably benign	0.20
R9242:Abcb4	UTSW	5	8899677	missense	probably damaging	1.00
R9376:Abcb4	UTSW	5	8958988	missense	probably damaging	1.00
R9476:Abcb4	UTSW	5	8927790	missense	probably damaging	1.00
RF015:Abcb4	UTSW	5	8896594	frame shift	probably null
RF047:Abcb4	UTSW	5	8896595	frame shift	probably null
Z1176:Abcb4	UTSW	5	8959005	missense	probably damaging	1.00
Z1177:Abcb4	UTSW	5	8939906	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTCAACCTTGTTGGGCAAATCC -3'
(R):5'- GACAACCTCATCTGCCCTTTGG -3'

Sequencing Primer
(F):5'- GCTGACATATAGCTCCGTGATAG -3'
(R):5'- GCCCTTTGGGTTTTATTTCTCAATC -3'

Posted On

2016-05-10