Mutagenetix > Incidental Mutations

Incidental Mutation 'R4994:Trappc11'

385104

Institutional Source

Beutler Lab

Gene Symbol

Trappc11

Ensembl Gene

ENSMUSG00000038102

Gene Name

trafficking protein particle complex 11

Synonyms

D030016E14Rik

MMRRC Submission

042588-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4994 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

47490115-47533470 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 47522441 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 247 (Y247*)

Ref Sequence

ENSEMBL: ENSMUSP00000047562 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039061]

Predicted Effect

probably null
Transcript: ENSMUST00000039061
AA Change: Y247*

SMART Domains

Protein: ENSMUSP00000047562
Gene: ENSMUSG00000038102
AA Change: Y247*

Domain	Start	End	E-Value	Type
Pfam:Foie-gras_1	263	522	3e-78	PFAM
Pfam:Gryzun	978	1114	3.9e-10	PFAM
Pfam:Gryzun-like	1036	1095	2.4e-28	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125065

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131551

Meta Mutation Damage Score

0.9701

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	C	A	9: 94,537,433	R148L	probably benign	Het
1700030K09Rik	A	G	8: 72,455,118	E364G	probably benign	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Abcb4	A	G	5: 8,928,524	T557A	probably damaging	Het
Acadm	C	T	3: 153,929,584	E298K	probably damaging	Het
Adrb3	T	C	8: 27,227,827		probably null	Het
Aldh1b1	A	G	4: 45,803,128	Y222C	possibly damaging	Het
Ankrd6	A	G	4: 32,860,387	Y19H	probably damaging	Het
Arhgap21	T	A	2: 20,849,890	T1554S	probably benign	Het
BC043934	T	C	9: 96,437,120		noncoding transcript	Het
Birc6	A	G	17: 74,594,324		probably benign	Het
Blm	A	C	7: 80,458,825	F1357C	probably benign	Het
Cd209a	T	C	8: 3,747,713		probably null	Het
Cdk7	G	A	13: 100,717,595	H129Y	probably damaging	Het
Clec14a	G	T	12: 58,268,284	P184Q	probably damaging	Het
Cma1	T	A	14: 55,941,671	I243F	probably damaging	Het
Cntnap3	G	T	13: 64,761,984	T769K	possibly damaging	Het
Col5a1	A	C	2: 28,032,739	K273T	possibly damaging	Het
Csnk1e	A	G	15: 79,424,929	Y266H	probably damaging	Het
Cyb5d1	A	G	11: 69,393,771	L185S	probably damaging	Het
Dennd5b	T	C	6: 149,041,500		probably null	Het
Drp2	G	A	X: 134,441,316	R567H	probably damaging	Homo
Dzank1	T	G	2: 144,522,566	D37A	probably damaging	Het
Echdc2	A	G	4: 108,165,628	I34V	probably benign	Het
Esm1	A	T	13: 113,213,431	R128S	probably benign	Het
Fbrsl1	A	G	5: 110,447,951	S73P	probably damaging	Het
Fbxo18	T	A	2: 11,764,230	I251F	probably damaging	Het
Fbxo6	A	T	4: 148,149,491	S49R	probably damaging	Het
Gm13089	T	A	4: 143,698,369	Q168L	possibly damaging	Het
Gm17093	A	T	14: 44,519,322	Q82L	probably damaging	Het
Hmcn2	T	C	2: 31,458,055		probably null	Het
Hspa4l	C	A	3: 40,745,649		probably benign	Het
Il3ra	G	A	14: 14,351,080	A201T	probably benign	Het
Irx5	T	A	8: 92,360,781	V447E	probably damaging	Het
Kif14	G	T	1: 136,482,959	L668F	probably damaging	Het
Lag3	T	A	6: 124,904,453	R519W	unknown	Het
Lgr4	A	G	2: 110,011,938	N756S	probably damaging	Het
Lingo4	A	G	3: 94,402,541	H262R	probably benign	Het
Lingo4	T	A	3: 94,403,001	H415Q	probably benign	Het
Lkaaear1	C	A	2: 181,697,583	G25*	probably null	Het
Marf1	T	C	16: 14,114,231	K1641E	probably benign	Het
Mtfmt	T	C	9: 65,443,851		probably benign	Het
Mtif3	G	A	5: 146,956,788	T203M	probably benign	Het
Mycbp2	A	G	14: 103,169,994	I2740T	probably benign	Het
Nrd1	A	G	4: 109,046,612	T720A	probably benign	Het
Olfr715	T	C	7: 107,129,064	T110A	probably benign	Het
Peak1	T	A	9: 56,241,276	D32V	possibly damaging	Het
Pigr	G	A	1: 130,841,817	D122N	probably benign	Het
Plekhg3	A	G	12: 76,565,537	R391G	possibly damaging	Het
Ppfia3	T	C	7: 45,341,118	D919G	probably damaging	Het
Rnase2b	T	A	14: 51,162,751	D96E	possibly damaging	Het
Rsf1	CGGCGGC	CGGCGGCCGCGGCGGC	7: 97,579,923		probably benign	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Serpina3f	A	G	12: 104,220,356	T394A	probably benign	Het
Six3	A	G	17: 85,621,292	N18S	possibly damaging	Het
Slc12a5	T	A	2: 164,983,365		probably null	Het
Slc35f6	A	G	5: 30,648,083	N21S	probably damaging	Het
Slc39a6	A	T	18: 24,596,294	I454N	probably damaging	Het
Slc40a1	T	A	1: 45,909,664	E485D	probably damaging	Het
Sort1	G	A	3: 108,328,069	C255Y	probably damaging	Het
Stab2	T	A	10: 86,949,907	T624S	probably benign	Het
Stk33	T	A	7: 109,340,398	I99L	probably benign	Het
Taf4b	T	A	18: 14,898,043	I828N	probably damaging	Het
Terf2	T	C	8: 107,076,478		probably benign	Het
Timd4	C	T	11: 46,815,517	R49C	probably damaging	Het
Tmem57	A	G	4: 134,828,299	Y288H	probably damaging	Het
Tpte	T	C	8: 22,318,346	S166P	probably benign	Het
Trabd2b	T	C	4: 114,406,855	L13P	probably benign	Het
Trnt1	C	T	6: 106,778,892	Q303*	probably null	Het
Tspyl5	T	A	15: 33,687,055	Q248L	possibly damaging	Het
Ubxn7	A	T	16: 32,381,504	K337N	probably damaging	Het
Unc13a	T	A	8: 71,643,172	I1234F	probably benign	Het
Vmn1r127	A	T	7: 21,319,018	F282I	probably damaging	Het
Wdhd1	A	T	14: 47,268,654		probably null	Het
Zfp605	A	G	5: 110,127,486	K157E	probably damaging	Het
Zhx2	T	A	15: 57,821,359	D41E	probably benign	Het

Other mutations in Trappc11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00324:Trappc11	APN	8	47503302	unclassified	probably benign
IGL01300:Trappc11	APN	8	47501868	missense	probably benign
IGL01312:Trappc11	APN	8	47505677	missense	possibly damaging	0.95
IGL01344:Trappc11	APN	8	47519704	missense	probably damaging	1.00
IGL01518:Trappc11	APN	8	47501869	splice site	probably null
IGL01747:Trappc11	APN	8	47519621	missense	probably benign	0.41
IGL01781:Trappc11	APN	8	47514128	missense	possibly damaging	0.95
IGL01908:Trappc11	APN	8	47503994	missense	probably damaging	1.00
IGL01956:Trappc11	APN	8	47528001	missense	possibly damaging	0.86
IGL02266:Trappc11	APN	8	47505731	missense	probably damaging	1.00
IGL02377:Trappc11	APN	8	47530650	critical splice donor site	probably null
IGL02530:Trappc11	APN	8	47507582	missense	probably damaging	1.00
IGL02676:Trappc11	APN	8	47493413	splice site	probably benign
IGL03030:Trappc11	APN	8	47513929	missense	probably damaging	0.98
IGL03393:Trappc11	APN	8	47510877	missense	possibly damaging	0.95
bunyoro	UTSW	8	47512285	splice site	probably null
nyoro	UTSW	8	47526979	missense	possibly damaging	0.73
serval	UTSW	8	47503965	missense	probably damaging	1.00
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0009:Trappc11	UTSW	8	47503320	missense	possibly damaging	0.70
R0043:Trappc11	UTSW	8	47505575	splice site	probably benign
R0180:Trappc11	UTSW	8	47527974	missense	possibly damaging	0.86
R0529:Trappc11	UTSW	8	47526979	missense	possibly damaging	0.73
R0538:Trappc11	UTSW	8	47503412	missense	probably benign	0.01
R0740:Trappc11	UTSW	8	47524588	missense	probably damaging	0.99
R1352:Trappc11	UTSW	8	47525046	missense	possibly damaging	0.90
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1469:Trappc11	UTSW	8	47503965	missense	probably damaging	1.00
R1502:Trappc11	UTSW	8	47530827	missense	possibly damaging	0.94
R1589:Trappc11	UTSW	8	47501680	missense	probably damaging	1.00
R1741:Trappc11	UTSW	8	47529327	critical splice donor site	probably null
R2292:Trappc11	UTSW	8	47505736	missense	probably damaging	1.00
R2303:Trappc11	UTSW	8	47503416	missense	probably damaging	0.99
R2931:Trappc11	UTSW	8	47503942	missense	probably damaging	0.99
R3522:Trappc11	UTSW	8	47498673	missense	possibly damaging	0.93
R3714:Trappc11	UTSW	8	47505316	intron	probably benign
R3739:Trappc11	UTSW	8	47514103	missense	probably damaging	0.98
R4165:Trappc11	UTSW	8	47524968	splice site	probably benign
R4581:Trappc11	UTSW	8	47493345	missense	probably damaging	0.97
R4598:Trappc11	UTSW	8	47513766	missense	probably damaging	0.98
R4939:Trappc11	UTSW	8	47519665	missense	probably damaging	1.00
R4990:Trappc11	UTSW	8	47490895	missense	probably benign	0.41
R5091:Trappc11	UTSW	8	47512604	missense	probably benign	0.00
R5123:Trappc11	UTSW	8	47513402	missense	probably damaging	0.99
R5176:Trappc11	UTSW	8	47510963	missense	possibly damaging	0.79
R5279:Trappc11	UTSW	8	47505304	intron	probably benign
R5293:Trappc11	UTSW	8	47493342	missense	possibly damaging	0.83
R5294:Trappc11	UTSW	8	47530731	missense	possibly damaging	0.88
R5661:Trappc11	UTSW	8	47512607	missense	probably damaging	0.99
R5838:Trappc11	UTSW	8	47512559	critical splice donor site	probably null
R5889:Trappc11	UTSW	8	47519578	missense	probably benign	0.40
R5952:Trappc11	UTSW	8	47496917	critical splice donor site	probably null
R5959:Trappc11	UTSW	8	47501558	missense	probably damaging	0.97
R6239:Trappc11	UTSW	8	47529494	missense	possibly damaging	0.73
R6322:Trappc11	UTSW	8	47530773	missense	possibly damaging	0.95
R6369:Trappc11	UTSW	8	47512285	splice site	probably null
R7541:Trappc11	UTSW	8	47505582	splice site	probably null
R7544:Trappc11	UTSW	8	47522414	missense	possibly damaging	0.73
R7762:Trappc11	UTSW	8	47522376	missense	probably damaging	0.99
R7964:Trappc11	UTSW	8	47526944	missense	possibly damaging	0.54
R8183:Trappc11	UTSW	8	47529356	missense	possibly damaging	0.93
R8282:Trappc11	UTSW	8	47516589	missense	probably damaging	0.97
R8733:Trappc11	UTSW	8	47501848	missense	probably damaging	1.00
R8782:Trappc11	UTSW	8	47498666	missense	probably benign	0.44
R8853:Trappc11	UTSW	8	47529404	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACCACCTTTATGGATCAAGAAACTG -3'
(R):5'- CAATAGGATGGGTCTTCTGCTG -3'

Sequencing Primer
(F):5'- AAATCCTGCCATCGTCTT -3'
(R):5'- CTGTATATGCCCCAGTACAGG -3'

Posted On

2016-05-10