Incidental Mutation 'R4994:Wdhd1'
List |< first << previous [record 75 of 77] next >> last >|
ID385126
Institutional Source Beutler Lab
Gene Symbol Wdhd1
Ensembl Gene ENSMUSG00000037572
Gene NameWD repeat and HMG-box DNA binding protein 1
SynonymsAND-1, D630024B06Rik
MMRRC Submission 042588-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4994 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location47240944-47276857 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 47268654 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111790] [ENSMUST00000111791] [ENSMUST00000111792] [ENSMUST00000187531]
Predicted Effect probably null
Transcript: ENSMUST00000111790
SMART Domains Protein: ENSMUSP00000107420
Gene: ENSMUSG00000037572

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:DUF3639 525 551 2.4e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111791
SMART Domains Protein: ENSMUSP00000107421
Gene: ENSMUSG00000037572

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:Mcl1_mid 424 708 1.6e-103 PFAM
coiled coil region 802 834 N/A INTRINSIC
HMG 1003 1073 2.64e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111792
SMART Domains Protein: ENSMUSP00000107422
Gene: ENSMUSG00000037572

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 316 326 N/A INTRINSIC
Pfam:DUF3639 488 514 7.1e-13 PFAM
coiled coil region 765 797 N/A INTRINSIC
HMG 966 1036 2.64e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139124
Predicted Effect probably null
Transcript: ENSMUST00000187531
SMART Domains Protein: ENSMUSP00000141182
Gene: ENSMUSG00000037572

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:DUF3639 525 551 3e-13 PFAM
coiled coil region 802 834 N/A INTRINSIC
HMG 1003 1073 2.64e-12 SMART
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains multiple N-terminal WD40 domains and a C-terminal high mobility group (HMG) box. WD40 domains are found in a variety of eukaryotic proteins and may function as adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik C A 9: 94,537,433 R148L probably benign Het
1700030K09Rik A G 8: 72,455,118 E364G probably benign Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Abcb4 A G 5: 8,928,524 T557A probably damaging Het
Acadm C T 3: 153,929,584 E298K probably damaging Het
Adrb3 T C 8: 27,227,827 probably null Het
Aldh1b1 A G 4: 45,803,128 Y222C possibly damaging Het
Ankrd6 A G 4: 32,860,387 Y19H probably damaging Het
Arhgap21 T A 2: 20,849,890 T1554S probably benign Het
BC043934 T C 9: 96,437,120 noncoding transcript Het
Birc6 A G 17: 74,594,324 probably benign Het
Blm A C 7: 80,458,825 F1357C probably benign Het
Cd209a T C 8: 3,747,713 probably null Het
Cdk7 G A 13: 100,717,595 H129Y probably damaging Het
Clec14a G T 12: 58,268,284 P184Q probably damaging Het
Cma1 T A 14: 55,941,671 I243F probably damaging Het
Cntnap3 G T 13: 64,761,984 T769K possibly damaging Het
Col5a1 A C 2: 28,032,739 K273T possibly damaging Het
Csnk1e A G 15: 79,424,929 Y266H probably damaging Het
Cyb5d1 A G 11: 69,393,771 L185S probably damaging Het
Dennd5b T C 6: 149,041,500 probably null Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Dzank1 T G 2: 144,522,566 D37A probably damaging Het
Echdc2 A G 4: 108,165,628 I34V probably benign Het
Esm1 A T 13: 113,213,431 R128S probably benign Het
Fbrsl1 A G 5: 110,447,951 S73P probably damaging Het
Fbxo18 T A 2: 11,764,230 I251F probably damaging Het
Fbxo6 A T 4: 148,149,491 S49R probably damaging Het
Gm13089 T A 4: 143,698,369 Q168L possibly damaging Het
Gm17093 A T 14: 44,519,322 Q82L probably damaging Het
Hmcn2 T C 2: 31,458,055 probably null Het
Hspa4l C A 3: 40,745,649 probably benign Het
Il3ra G A 14: 14,351,080 A201T probably benign Het
Irx5 T A 8: 92,360,781 V447E probably damaging Het
Kif14 G T 1: 136,482,959 L668F probably damaging Het
Lag3 T A 6: 124,904,453 R519W unknown Het
Lgr4 A G 2: 110,011,938 N756S probably damaging Het
Lingo4 A G 3: 94,402,541 H262R probably benign Het
Lingo4 T A 3: 94,403,001 H415Q probably benign Het
Lkaaear1 C A 2: 181,697,583 G25* probably null Het
Marf1 T C 16: 14,114,231 K1641E probably benign Het
Mtfmt T C 9: 65,443,851 probably benign Het
Mtif3 G A 5: 146,956,788 T203M probably benign Het
Mycbp2 A G 14: 103,169,994 I2740T probably benign Het
Nrd1 A G 4: 109,046,612 T720A probably benign Het
Olfr715 T C 7: 107,129,064 T110A probably benign Het
Peak1 T A 9: 56,241,276 D32V possibly damaging Het
Pigr G A 1: 130,841,817 D122N probably benign Het
Plekhg3 A G 12: 76,565,537 R391G possibly damaging Het
Ppfia3 T C 7: 45,341,118 D919G probably damaging Het
Rnase2b T A 14: 51,162,751 D96E possibly damaging Het
Rsf1 CGGCGGC CGGCGGCCGCGGCGGC 7: 97,579,923 probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Het
Serpina3f A G 12: 104,220,356 T394A probably benign Het
Six3 A G 17: 85,621,292 N18S possibly damaging Het
Slc12a5 T A 2: 164,983,365 probably null Het
Slc35f6 A G 5: 30,648,083 N21S probably damaging Het
Slc39a6 A T 18: 24,596,294 I454N probably damaging Het
Slc40a1 T A 1: 45,909,664 E485D probably damaging Het
Sort1 G A 3: 108,328,069 C255Y probably damaging Het
Stab2 T A 10: 86,949,907 T624S probably benign Het
Stk33 T A 7: 109,340,398 I99L probably benign Het
Taf4b T A 18: 14,898,043 I828N probably damaging Het
Terf2 T C 8: 107,076,478 probably benign Het
Timd4 C T 11: 46,815,517 R49C probably damaging Het
Tmem57 A G 4: 134,828,299 Y288H probably damaging Het
Tpte T C 8: 22,318,346 S166P probably benign Het
Trabd2b T C 4: 114,406,855 L13P probably benign Het
Trappc11 A T 8: 47,522,441 Y247* probably null Het
Trnt1 C T 6: 106,778,892 Q303* probably null Het
Tspyl5 T A 15: 33,687,055 Q248L possibly damaging Het
Ubxn7 A T 16: 32,381,504 K337N probably damaging Het
Unc13a T A 8: 71,643,172 I1234F probably benign Het
Vmn1r127 A T 7: 21,319,018 F282I probably damaging Het
Zfp605 A G 5: 110,127,486 K157E probably damaging Het
Zhx2 T A 15: 57,821,359 D41E probably benign Het
Other mutations in Wdhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Wdhd1 APN 14 47250782 missense possibly damaging 0.87
IGL01789:Wdhd1 APN 14 47274817 missense probably benign 0.10
IGL01981:Wdhd1 APN 14 47261450 missense probably damaging 1.00
IGL02034:Wdhd1 APN 14 47261351 missense probably benign 0.02
IGL02932:Wdhd1 APN 14 47272134 critical splice donor site probably null
IGL02966:Wdhd1 APN 14 47241644 missense possibly damaging 0.93
IGL03355:Wdhd1 APN 14 47243889 missense possibly damaging 0.78
R0165:Wdhd1 UTSW 14 47267068 missense probably benign 0.00
R0414:Wdhd1 UTSW 14 47276588 missense probably benign
R0603:Wdhd1 UTSW 14 47263586 missense probably damaging 1.00
R1503:Wdhd1 UTSW 14 47247400 missense probably benign 0.00
R1539:Wdhd1 UTSW 14 47245050 missense possibly damaging 0.63
R1541:Wdhd1 UTSW 14 47268192 nonsense probably null
R1588:Wdhd1 UTSW 14 47256236 missense probably damaging 1.00
R1686:Wdhd1 UTSW 14 47256215 missense probably damaging 1.00
R1916:Wdhd1 UTSW 14 47258577 missense possibly damaging 0.89
R1952:Wdhd1 UTSW 14 47270190 missense probably damaging 1.00
R2320:Wdhd1 UTSW 14 47274028 missense probably benign 0.06
R2421:Wdhd1 UTSW 14 47258584 missense probably benign 0.00
R3731:Wdhd1 UTSW 14 47247892 missense possibly damaging 0.89
R3818:Wdhd1 UTSW 14 47243801 critical splice donor site probably null
R3836:Wdhd1 UTSW 14 47245054 missense probably benign 0.01
R4789:Wdhd1 UTSW 14 47268692 missense probably benign 0.01
R4963:Wdhd1 UTSW 14 47268689 missense possibly damaging 0.66
R5225:Wdhd1 UTSW 14 47250816 missense probably benign 0.01
R5347:Wdhd1 UTSW 14 47268724 nonsense probably null
R5377:Wdhd1 UTSW 14 47272221 missense probably benign 0.15
R6038:Wdhd1 UTSW 14 47263580 missense possibly damaging 0.89
R6038:Wdhd1 UTSW 14 47263580 missense possibly damaging 0.89
R6046:Wdhd1 UTSW 14 47273210 nonsense probably null
R6156:Wdhd1 UTSW 14 47268196 missense probably damaging 0.99
R6289:Wdhd1 UTSW 14 47258496 missense possibly damaging 0.95
R6298:Wdhd1 UTSW 14 47273122 missense possibly damaging 0.67
R6345:Wdhd1 UTSW 14 47251922 missense probably damaging 0.99
R6405:Wdhd1 UTSW 14 47243867 missense possibly damaging 0.91
R6500:Wdhd1 UTSW 14 47250760 splice site probably null
R6564:Wdhd1 UTSW 14 47248042 missense probably benign
R6897:Wdhd1 UTSW 14 47248130 missense probably damaging 1.00
R7262:Wdhd1 UTSW 14 47251973 missense probably benign 0.08
R7444:Wdhd1 UTSW 14 47251948 nonsense probably null
R7496:Wdhd1 UTSW 14 47274024 missense probably benign 0.39
R7503:Wdhd1 UTSW 14 47250791 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CATGTATTCAATCCTTAGCACCAC -3'
(R):5'- CTCCTGGCTAACAAAATGACATG -3'

Sequencing Primer
(F):5'- TGTCACCAAGCCTGCACTG -3'
(R):5'- GGCTAACAAAATGACATGATATTTGC -3'
Posted On2016-05-10