Mutagenetix > Incidental Mutation

Incidental Mutation 'R4994:Zhx2'

385131

Institutional Source

Beutler Lab

Gene Symbol

Zhx2

Ensembl Gene

ENSMUSG00000071757

Gene Name

zinc fingers and homeoboxes 2

Synonyms

Afr1, Raf, Afr-1

MMRRC Submission

042588-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.280) question?

Stock #

R4994 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57694665-57839832 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 57821359 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 41 (D41E)

Ref Sequence

ENSEMBL: ENSMUSP00000094164 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096430]

AlphaFold

Q8C0C0

Predicted Effect

probably benign
Transcript: ENSMUST00000096430
AA Change: D41E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000094164
Gene: ENSMUSG00000071757
AA Change: D41E

Domain	Start	End	E-Value	Type
ZnF_C2H2	78	101	1.79e-2	SMART
ZnF_C2H2	110	133	1.99e0	SMART
low complexity region	191	209	N/A	INTRINSIC
HOX	263	324	2.11e-3	SMART
HOX	439	501	4.94e-8	SMART
HOX	530	591	2.8e-7	SMART
HOX	628	690	3.09e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160990

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 2 of this gene family. In addition to forming homodimers, this protein heterodimerizes with member 1 of the zinc fingers and homeoboxes family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Alpha-fetoprotein levels in plasma decline precipitously after birth. This gene regulates a difference in adult level and rate of neonatal decrease of AFP. The BALB/cJ substrain carries a genetic variant allele determining a slow rate of decline to adultlevel. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	C	A	9: 94,537,433	R148L	probably benign	Het
1700030K09Rik	A	G	8: 72,455,118	E364G	probably benign	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Abcb4	A	G	5: 8,928,524	T557A	probably damaging	Het
Acadm	C	T	3: 153,929,584	E298K	probably damaging	Het
Adrb3	T	C	8: 27,227,827		probably null	Het
Aldh1b1	A	G	4: 45,803,128	Y222C	possibly damaging	Het
Ankrd6	A	G	4: 32,860,387	Y19H	probably damaging	Het
Arhgap21	T	A	2: 20,849,890	T1554S	probably benign	Het
BC043934	T	C	9: 96,437,120		noncoding transcript	Het
Birc6	A	G	17: 74,594,324		probably benign	Het
Blm	A	C	7: 80,458,825	F1357C	probably benign	Het
Cd209a	T	C	8: 3,747,713		probably null	Het
Cdk7	G	A	13: 100,717,595	H129Y	probably damaging	Het
Clec14a	G	T	12: 58,268,284	P184Q	probably damaging	Het
Cma1	T	A	14: 55,941,671	I243F	probably damaging	Het
Cntnap3	G	T	13: 64,761,984	T769K	possibly damaging	Het
Col5a1	A	C	2: 28,032,739	K273T	possibly damaging	Het
Csnk1e	A	G	15: 79,424,929	Y266H	probably damaging	Het
Cyb5d1	A	G	11: 69,393,771	L185S	probably damaging	Het
Dennd5b	T	C	6: 149,041,500		probably null	Het
Drp2	G	A	X: 134,441,316	R567H	probably damaging	Homo
Dzank1	T	G	2: 144,522,566	D37A	probably damaging	Het
Echdc2	A	G	4: 108,165,628	I34V	probably benign	Het
Esm1	A	T	13: 113,213,431	R128S	probably benign	Het
Fbrsl1	A	G	5: 110,447,951	S73P	probably damaging	Het
Fbxo18	T	A	2: 11,764,230	I251F	probably damaging	Het
Fbxo6	A	T	4: 148,149,491	S49R	probably damaging	Het
Gm13089	T	A	4: 143,698,369	Q168L	possibly damaging	Het
Gm17093	A	T	14: 44,519,322	Q82L	probably damaging	Het
Hmcn2	T	C	2: 31,458,055		probably null	Het
Hspa4l	C	A	3: 40,745,649		probably benign	Het
Il3ra	G	A	14: 14,351,080	A201T	probably benign	Het
Irx5	T	A	8: 92,360,781	V447E	probably damaging	Het
Kif14	G	T	1: 136,482,959	L668F	probably damaging	Het
Lag3	T	A	6: 124,904,453	R519W	unknown	Het
Lgr4	A	G	2: 110,011,938	N756S	probably damaging	Het
Lingo4	A	G	3: 94,402,541	H262R	probably benign	Het
Lingo4	T	A	3: 94,403,001	H415Q	probably benign	Het
Lkaaear1	C	A	2: 181,697,583	G25*	probably null	Het
Marf1	T	C	16: 14,114,231	K1641E	probably benign	Het
Mtfmt	T	C	9: 65,443,851		probably benign	Het
Mtif3	G	A	5: 146,956,788	T203M	probably benign	Het
Mycbp2	A	G	14: 103,169,994	I2740T	probably benign	Het
Nrd1	A	G	4: 109,046,612	T720A	probably benign	Het
Olfr715	T	C	7: 107,129,064	T110A	probably benign	Het
Peak1	T	A	9: 56,241,276	D32V	possibly damaging	Het
Pigr	G	A	1: 130,841,817	D122N	probably benign	Het
Plekhg3	A	G	12: 76,565,537	R391G	possibly damaging	Het
Ppfia3	T	C	7: 45,341,118	D919G	probably damaging	Het
Rnase2b	T	A	14: 51,162,751	D96E	possibly damaging	Het
Rsf1	CGGCGGC	CGGCGGCCGCGGCGGC	7: 97,579,923		probably benign	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Serpina3f	A	G	12: 104,220,356	T394A	probably benign	Het
Six3	A	G	17: 85,621,292	N18S	possibly damaging	Het
Slc12a5	T	A	2: 164,983,365		probably null	Het
Slc35f6	A	G	5: 30,648,083	N21S	probably damaging	Het
Slc39a6	A	T	18: 24,596,294	I454N	probably damaging	Het
Slc40a1	T	A	1: 45,909,664	E485D	probably damaging	Het
Sort1	G	A	3: 108,328,069	C255Y	probably damaging	Het
Stab2	T	A	10: 86,949,907	T624S	probably benign	Het
Stk33	T	A	7: 109,340,398	I99L	probably benign	Het
Taf4b	T	A	18: 14,898,043	I828N	probably damaging	Het
Terf2	T	C	8: 107,076,478		probably benign	Het
Timd4	C	T	11: 46,815,517	R49C	probably damaging	Het
Tmem57	A	G	4: 134,828,299	Y288H	probably damaging	Het
Tpte	T	C	8: 22,318,346	S166P	probably benign	Het
Trabd2b	T	C	4: 114,406,855	L13P	probably benign	Het
Trappc11	A	T	8: 47,522,441	Y247*	probably null	Het
Trnt1	C	T	6: 106,778,892	Q303*	probably null	Het
Tspyl5	T	A	15: 33,687,055	Q248L	possibly damaging	Het
Ubxn7	A	T	16: 32,381,504	K337N	probably damaging	Het
Unc13a	T	A	8: 71,643,172	I1234F	probably benign	Het
Vmn1r127	A	T	7: 21,319,018	F282I	probably damaging	Het
Wdhd1	A	T	14: 47,268,654		probably null	Het
Zfp605	A	G	5: 110,127,486	K157E	probably damaging	Het

Other mutations in Zhx2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Zhx2	APN	15	57822870	missense	probably damaging	1.00
IGL00694:Zhx2	APN	15	57821760	missense	probably benign
IGL02407:Zhx2	APN	15	57823406	missense	probably benign	0.00
IGL02456:Zhx2	APN	15	57823639	missense	possibly damaging	0.72
IGL02737:Zhx2	APN	15	57822267	missense	probably damaging	1.00
Gross	UTSW	15	57822728	missense	probably damaging	1.00
Lange	UTSW	15	57822176	missense	probably damaging	1.00
IGL03050:Zhx2	UTSW	15	57822833	missense	possibly damaging	0.90
R0010:Zhx2	UTSW	15	57821274	missense	possibly damaging	0.92
R0105:Zhx2	UTSW	15	57822695	missense	probably damaging	1.00
R0420:Zhx2	UTSW	15	57821840	missense	probably damaging	1.00
R0799:Zhx2	UTSW	15	57821313	missense	probably benign
R0800:Zhx2	UTSW	15	57822728	missense	probably damaging	1.00
R2273:Zhx2	UTSW	15	57823169	missense	probably benign	0.30
R2497:Zhx2	UTSW	15	57823155	missense	possibly damaging	0.48
R4198:Zhx2	UTSW	15	57821729	missense	probably benign
R4372:Zhx2	UTSW	15	57823301	missense	probably benign	0.02
R4992:Zhx2	UTSW	15	57823587	missense	probably damaging	0.96
R5085:Zhx2	UTSW	15	57822693	missense	probably damaging	1.00
R5141:Zhx2	UTSW	15	57821786	missense	probably benign	0.00
R5470:Zhx2	UTSW	15	57823074	missense	possibly damaging	0.76
R5659:Zhx2	UTSW	15	57822308	missense	probably benign
R5710:Zhx2	UTSW	15	57821470	nonsense	probably null
R6171:Zhx2	UTSW	15	57823206	missense	probably damaging	1.00
R7181:Zhx2	UTSW	15	57823350	missense	probably benign
R7215:Zhx2	UTSW	15	57823643	missense	probably benign
R7273:Zhx2	UTSW	15	57823428	missense	probably benign	0.09
R7575:Zhx2	UTSW	15	57823262	missense	probably damaging	1.00
R7662:Zhx2	UTSW	15	57822176	missense	probably damaging	1.00
R7883:Zhx2	UTSW	15	57821874	missense	possibly damaging	0.67
R7966:Zhx2	UTSW	15	57821667	missense	probably damaging	0.99
R8824:Zhx2	UTSW	15	57821280	missense	probably damaging	0.96
R9111:Zhx2	UTSW	15	57822588	missense	probably damaging	1.00
R9742:Zhx2	UTSW	15	57823410	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGAATCTCACTGTCCTGCAC -3'
(R):5'- TTCGGCACATACGTAGAGGG -3'

Sequencing Primer
(F):5'- ACTGTCCTGCACCCACC -3'
(R):5'- CACGTTAGGATGTTGCATGTCCAC -3'

Posted On

2016-05-10