Mutagenetix > Incidental Mutations

Incidental Mutation 'R4994:Six3'

385136

Institutional Source

Beutler Lab

Gene Symbol

Six3

Ensembl Gene

ENSMUSG00000038805

Gene Name

sine oculis-related homeobox 3

Synonyms

E130112M24Rik

MMRRC Submission

042588-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4994 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

85613608-85629302 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 85621292 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 18 (N18S)

Ref Sequence

ENSEMBL: ENSMUSP00000125169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000162695] [ENSMUST00000175898] [ENSMUST00000176081]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159030

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000160691

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161146

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161688

Predicted Effect

possibly damaging
Transcript: ENSMUST00000162695
AA Change: N18S

PolyPhen 2 Score 0.909 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000125169
Gene: ENSMUSG00000038805
AA Change: N18S

Domain	Start	End	E-Value	Type
low complexity region	30	71	N/A	INTRINSIC
HOX	208	269	1.26e-14	SMART
low complexity region	294	310	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000175898
AA Change: N18S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000135677
Gene: ENSMUSG00000038805
AA Change: N18S

Domain	Start	End	E-Value	Type
low complexity region	30	71	N/A	INTRINSIC
HOX	208	269	1.26e-14	SMART
low complexity region	294	310	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175913

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176081
AA Change: N18S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000135312
Gene: ENSMUSG00000038805
AA Change: N18S

Domain	Start	End	E-Value	Type
low complexity region	51	92	N/A	INTRINSIC
Pfam:SIX1_SD	109	223	6e-47	PFAM
HOX	229	290	6.5e-17	SMART
low complexity region	315	331	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176432

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176556

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176917

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176958

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177220

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000188560

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183495

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185134

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177487

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184318

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.0%

Validation Efficiency

100% (79/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sine oculis homeobox transcription factor family. The encoded protein plays a role in eye development. Mutations in this gene have been associated with holoprosencephaly type 2. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for disruptions of this gene die at birth with anterior structures of the head and brain undeveloped. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	C	A	9: 94,537,433	R148L	probably benign	Het
1700030K09Rik	A	G	8: 72,455,118	E364G	probably benign	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Abcb4	A	G	5: 8,928,524	T557A	probably damaging	Het
Acadm	C	T	3: 153,929,584	E298K	probably damaging	Het
Adrb3	T	C	8: 27,227,827		probably null	Het
Aldh1b1	A	G	4: 45,803,128	Y222C	possibly damaging	Het
Ankrd6	A	G	4: 32,860,387	Y19H	probably damaging	Het
Arhgap21	T	A	2: 20,849,890	T1554S	probably benign	Het
BC043934	T	C	9: 96,437,120		noncoding transcript	Het
Birc6	A	G	17: 74,594,324		probably benign	Het
Blm	A	C	7: 80,458,825	F1357C	probably benign	Het
Cd209a	T	C	8: 3,747,713		probably null	Het
Cdk7	G	A	13: 100,717,595	H129Y	probably damaging	Het
Clec14a	G	T	12: 58,268,284	P184Q	probably damaging	Het
Cma1	T	A	14: 55,941,671	I243F	probably damaging	Het
Cntnap3	G	T	13: 64,761,984	T769K	possibly damaging	Het
Col5a1	A	C	2: 28,032,739	K273T	possibly damaging	Het
Csnk1e	A	G	15: 79,424,929	Y266H	probably damaging	Het
Cyb5d1	A	G	11: 69,393,771	L185S	probably damaging	Het
Dennd5b	T	C	6: 149,041,500		probably null	Het
Drp2	G	A	X: 134,441,316	R567H	probably damaging	Homo
Dzank1	T	G	2: 144,522,566	D37A	probably damaging	Het
Echdc2	A	G	4: 108,165,628	I34V	probably benign	Het
Esm1	A	T	13: 113,213,431	R128S	probably benign	Het
Fbrsl1	A	G	5: 110,447,951	S73P	probably damaging	Het
Fbxo18	T	A	2: 11,764,230	I251F	probably damaging	Het
Fbxo6	A	T	4: 148,149,491	S49R	probably damaging	Het
Gm13089	T	A	4: 143,698,369	Q168L	possibly damaging	Het
Gm17093	A	T	14: 44,519,322	Q82L	probably damaging	Het
Hmcn2	T	C	2: 31,458,055		probably null	Het
Hspa4l	C	A	3: 40,745,649		probably benign	Het
Il3ra	G	A	14: 14,351,080	A201T	probably benign	Het
Irx5	T	A	8: 92,360,781	V447E	probably damaging	Het
Kif14	G	T	1: 136,482,959	L668F	probably damaging	Het
Lag3	T	A	6: 124,904,453	R519W	unknown	Het
Lgr4	A	G	2: 110,011,938	N756S	probably damaging	Het
Lingo4	A	G	3: 94,402,541	H262R	probably benign	Het
Lingo4	T	A	3: 94,403,001	H415Q	probably benign	Het
Lkaaear1	C	A	2: 181,697,583	G25*	probably null	Het
Marf1	T	C	16: 14,114,231	K1641E	probably benign	Het
Mtfmt	T	C	9: 65,443,851		probably benign	Het
Mtif3	G	A	5: 146,956,788	T203M	probably benign	Het
Mycbp2	A	G	14: 103,169,994	I2740T	probably benign	Het
Nrd1	A	G	4: 109,046,612	T720A	probably benign	Het
Olfr715	T	C	7: 107,129,064	T110A	probably benign	Het
Peak1	T	A	9: 56,241,276	D32V	possibly damaging	Het
Pigr	G	A	1: 130,841,817	D122N	probably benign	Het
Plekhg3	A	G	12: 76,565,537	R391G	possibly damaging	Het
Ppfia3	T	C	7: 45,341,118	D919G	probably damaging	Het
Rnase2b	T	A	14: 51,162,751	D96E	possibly damaging	Het
Rsf1	CGGCGGC	CGGCGGCCGCGGCGGC	7: 97,579,923		probably benign	Het
Rsf1	G	GACGGCGGCT	7: 97,579,909		probably benign	Het
Serpina3f	A	G	12: 104,220,356	T394A	probably benign	Het
Slc12a5	T	A	2: 164,983,365		probably null	Het
Slc35f6	A	G	5: 30,648,083	N21S	probably damaging	Het
Slc39a6	A	T	18: 24,596,294	I454N	probably damaging	Het
Slc40a1	T	A	1: 45,909,664	E485D	probably damaging	Het
Sort1	G	A	3: 108,328,069	C255Y	probably damaging	Het
Stab2	T	A	10: 86,949,907	T624S	probably benign	Het
Stk33	T	A	7: 109,340,398	I99L	probably benign	Het
Taf4b	T	A	18: 14,898,043	I828N	probably damaging	Het
Terf2	T	C	8: 107,076,478		probably benign	Het
Timd4	C	T	11: 46,815,517	R49C	probably damaging	Het
Tmem57	A	G	4: 134,828,299	Y288H	probably damaging	Het
Tpte	T	C	8: 22,318,346	S166P	probably benign	Het
Trabd2b	T	C	4: 114,406,855	L13P	probably benign	Het
Trappc11	A	T	8: 47,522,441	Y247*	probably null	Het
Trnt1	C	T	6: 106,778,892	Q303*	probably null	Het
Tspyl5	T	A	15: 33,687,055	Q248L	possibly damaging	Het
Ubxn7	A	T	16: 32,381,504	K337N	probably damaging	Het
Unc13a	T	A	8: 71,643,172	I1234F	probably benign	Het
Vmn1r127	A	T	7: 21,319,018	F282I	probably damaging	Het
Wdhd1	A	T	14: 47,268,654		probably null	Het
Zfp605	A	G	5: 110,127,486	K157E	probably damaging	Het
Zhx2	T	A	15: 57,821,359	D41E	probably benign	Het

Other mutations in Six3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03096:Six3	APN	17	85621937	missense	possibly damaging	0.78
IGL03397:Six3	APN	17	85621646	missense	probably damaging	1.00
FR4304:Six3	UTSW	17	85621368	small insertion	probably benign
FR4340:Six3	UTSW	17	85621356	small insertion	probably benign
FR4449:Six3	UTSW	17	85621362	small insertion	probably benign
FR4548:Six3	UTSW	17	85621363	small insertion	probably benign
FR4589:Six3	UTSW	17	85621365	small insertion	probably benign
FR4737:Six3	UTSW	17	85621357	small insertion	probably benign
FR4737:Six3	UTSW	17	85621358	small insertion	probably benign
FR4737:Six3	UTSW	17	85621362	small insertion	probably benign
FR4737:Six3	UTSW	17	85621363	small insertion	probably benign
FR4737:Six3	UTSW	17	85621365	small insertion	probably benign
FR4737:Six3	UTSW	17	85621368	small insertion	probably benign
FR4976:Six3	UTSW	17	85621358	small insertion	probably benign
FR4976:Six3	UTSW	17	85621371	small insertion	probably benign
R0238:Six3	UTSW	17	85621390	missense	probably damaging	1.00
R1264:Six3	UTSW	17	85621857	missense	probably damaging	0.96
R2903:Six3	UTSW	17	85623855	missense	probably damaging	0.96
R2916:Six3	UTSW	17	85621633	missense	probably benign	0.25
R5393:Six3	UTSW	17	85623842	missense	possibly damaging	0.93
R6524:Six3	UTSW	17	85621970	missense	probably damaging	1.00
RF003:Six3	UTSW	17	85621370	small insertion	probably benign
RF010:Six3	UTSW	17	85621355	small insertion	probably benign
RF011:Six3	UTSW	17	85621368	small insertion	probably benign
RF012:Six3	UTSW	17	85621368	small insertion	probably benign
RF014:Six3	UTSW	17	85621356	small insertion	probably benign
RF015:Six3	UTSW	17	85621370	small insertion	probably benign
RF022:Six3	UTSW	17	85621356	small insertion	probably benign
RF054:Six3	UTSW	17	85621355	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAATCTTGACTCGGCCGTG -3'
(R):5'- AACATGGACAACTCTTCCGGG -3'

Sequencing Primer
(F):5'- GTGGGTGTCCCTTACGTCC -3'
(R):5'- AACTCTTCCGGGGGGGCCCTGGAGCC -3'

Posted On

2016-05-10