Incidental Mutation 'R4995:Nelfb'
ID 385148
Institutional Source Beutler Lab
Gene Symbol Nelfb
Ensembl Gene ENSMUSG00000013465
Gene Name negative elongation factor complex member B
Synonyms A730008L03Rik, Cobra1
MMRRC Submission 042589-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4995 (G1)
Quality Score 180
Status Validated
Chromosome 2
Chromosomal Location 25089724-25101501 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 25096208 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 300 (D300E)
Ref Sequence ENSEMBL: ENSMUSP00000057731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059849]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000059849
AA Change: D300E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000057731
Gene: ENSMUSG00000013465
AA Change: D300E

DomainStartEndE-ValueType
Pfam:COBRA1 107 578 3.5e-248 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082985
Predicted Effect probably benign
Transcript: ENSMUST00000124900
SMART Domains Protein: ENSMUSP00000115296
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 1 144 1.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138199
Predicted Effect unknown
Transcript: ENSMUST00000140934
AA Change: D89E
SMART Domains Protein: ENSMUSP00000115698
Gene: ENSMUSG00000013465
AA Change: D89E

DomainStartEndE-ValueType
Pfam:COBRA1 40 204 9.7e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205741
AA Change: D249E
Meta Mutation Damage Score 0.0723 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: This gene encodes subunit B of a metazoan-specific, four-subunit protein complex that regulates promoter-proximal pausing of RNA polymerase II. RNA polymerase II pausing is thought to be important for coordination of gene transcription during embryonic development and stress responses. Consistently, disruption of this gene in mouse causes inner cell mass deficiency and embryonic lethality. In addition, this gene is required for maintenance of mouse embryonic stem cells by preventing expression of developmental genes. In adult mice, conditional deletion of this gene results in cardiomyopathy and impaired response to cardiac stress. Multiple protein isoforms are encoded through the use of a non-AUG (CUG) initiation codon and an alternative downstream AUG initiation codon. In addition, alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a knock-out allele fail to develop inner cell masses and die between E5 and E13.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,498,995 (GRCm39) Q333* probably null Het
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Acvrl1 G A 15: 101,033,741 (GRCm39) R141H probably benign Het
Adprm A G 11: 66,932,436 (GRCm39) F158L possibly damaging Het
Aldoart2 C T 12: 55,613,038 (GRCm39) T321M probably benign Het
Ap3m2 A G 8: 23,293,792 (GRCm39) V86A probably benign Het
Arhgef19 T A 4: 140,974,826 (GRCm39) probably null Het
Bcl2l12 T G 7: 44,643,615 (GRCm39) probably null Het
Bptf T C 11: 106,945,391 (GRCm39) Q2501R probably damaging Het
C230029F24Rik A T 1: 49,377,295 (GRCm39) noncoding transcript Het
C7 C T 15: 5,079,074 (GRCm39) G78D probably damaging Het
Caly T C 7: 139,650,538 (GRCm39) T135A probably benign Het
Cbl A G 9: 44,065,108 (GRCm39) M740T possibly damaging Het
Cbx4 A G 11: 118,972,037 (GRCm39) V446A probably benign Het
Celsr1 C A 15: 85,822,112 (GRCm39) R1735L probably damaging Het
Cep250 A G 2: 155,830,236 (GRCm39) D135G probably damaging Het
Cgn T C 3: 94,687,246 (GRCm39) T19A probably damaging Het
Chic2 A T 5: 75,204,865 (GRCm39) V32D probably damaging Het
Cntln A G 4: 84,968,120 (GRCm39) K780E probably benign Het
Col8a2 A T 4: 126,204,581 (GRCm39) D197V probably damaging Het
Crot A T 5: 9,024,000 (GRCm39) V372E probably damaging Het
Cyb561d2 C T 9: 107,418,747 (GRCm39) V26M probably damaging Het
Ddx5 G A 11: 106,676,062 (GRCm39) T237I probably damaging Het
Dmxl2 G T 9: 54,408,725 (GRCm39) probably benign Het
Dock8 T A 19: 25,135,747 (GRCm39) S1188R probably benign Het
Ehbp1 T A 11: 22,051,073 (GRCm39) H493L probably damaging Het
Eif5b T A 1: 38,090,792 (GRCm39) *1217K probably null Het
Eprs1 A G 1: 185,142,336 (GRCm39) probably benign Het
Etfdh T C 3: 79,513,095 (GRCm39) D376G probably benign Het
Fam186a T C 15: 99,842,980 (GRCm39) Q1088R probably benign Het
Fbxw16 G T 9: 109,270,318 (GRCm39) T141N probably damaging Het
Fgf11 G A 11: 69,689,585 (GRCm39) H138Y probably damaging Het
Htra3 T C 5: 35,828,418 (GRCm39) E154G probably damaging Het
Hydin T A 8: 111,296,274 (GRCm39) V3601D probably damaging Het
Jup G T 11: 100,270,367 (GRCm39) S380* probably null Het
Klrg1 T A 6: 122,255,234 (GRCm39) D66V probably benign Het
Llgl1 C T 11: 60,600,550 (GRCm39) A633V probably benign Het
Lmln T A 16: 32,894,467 (GRCm39) Y203* probably null Het
Lrrc58 T G 16: 37,697,418 (GRCm39) C165G probably benign Het
Lss T C 10: 76,383,371 (GRCm39) V557A probably benign Het
Mast4 T C 13: 103,042,262 (GRCm39) probably benign Het
Med13l C A 5: 118,869,014 (GRCm39) P754Q possibly damaging Het
Mga C T 2: 119,763,063 (GRCm39) R1240* probably null Het
Mgat5b T A 11: 116,865,025 (GRCm39) probably null Het
Mtor A G 4: 148,610,209 (GRCm39) D1572G probably damaging Het
Muc4 T A 16: 32,754,214 (GRCm38) S1363T probably benign Het
Muc4 T A 16: 32,575,332 (GRCm39) S1306T probably benign Het
Myo18b A G 5: 112,908,258 (GRCm39) V2005A probably damaging Het
Myo1e G A 9: 70,260,554 (GRCm39) D571N probably benign Het
Mypn T C 10: 62,955,747 (GRCm39) probably null Het
Ndufb10 T C 17: 24,941,731 (GRCm39) probably null Het
Nicol1 G A 5: 34,142,270 (GRCm39) R79H probably damaging Het
Odad2 G A 18: 7,223,663 (GRCm39) T460M probably damaging Het
Or2y1d T A 11: 49,321,482 (GRCm39) Y60N probably damaging Het
Or4e5 A T 14: 52,727,988 (GRCm39) C61* probably null Het
Or52n2c T A 7: 104,574,942 (GRCm39) T10S probably benign Het
Or52z15 T A 7: 103,332,574 (GRCm39) D206E probably damaging Het
Pcdha11 C T 18: 37,144,080 (GRCm39) T57M probably benign Het
Pkp1 A T 1: 135,808,593 (GRCm39) I458N possibly damaging Het
Prr12 T A 7: 44,700,653 (GRCm39) probably benign Het
Prrc2c A T 1: 162,532,879 (GRCm39) probably benign Het
Psd4 T C 2: 24,287,259 (GRCm39) F397S probably benign Het
Pygm T C 19: 6,448,169 (GRCm39) I737T probably damaging Het
Rfx1 T A 8: 84,806,743 (GRCm39) probably null Het
Rsl1 A G 13: 67,330,313 (GRCm39) T254A possibly damaging Het
Sh3rf3 A G 10: 58,922,646 (GRCm39) Q574R probably benign Het
Spire1 T C 18: 67,685,849 (GRCm39) probably null Het
St6galnac4 G A 2: 32,484,075 (GRCm39) G91D probably damaging Het
Sytl2 T C 7: 90,031,465 (GRCm39) probably benign Het
Tbpl2 T A 2: 23,983,872 (GRCm39) K188N possibly damaging Het
Tenm3 A T 8: 48,682,172 (GRCm39) M2486K possibly damaging Het
Tgoln1 A C 6: 72,593,123 (GRCm39) V119G possibly damaging Het
Tpgs1 A T 10: 79,505,325 (GRCm39) N28Y probably benign Het
U2surp A C 9: 95,344,847 (GRCm39) probably benign Het
Vmn2r103 A G 17: 19,993,773 (GRCm39) H50R probably benign Het
Vmn2r19 A G 6: 123,306,869 (GRCm39) N459S probably benign Het
Vmn2r72 T C 7: 85,387,693 (GRCm39) S624G probably damaging Het
Vps13c A G 9: 67,826,603 (GRCm39) T1415A probably benign Het
Vwa5b1 G A 4: 138,336,154 (GRCm39) P147S probably damaging Het
Other mutations in Nelfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Nelfb APN 2 25,094,300 (GRCm39) missense possibly damaging 0.94
IGL01573:Nelfb APN 2 25,093,969 (GRCm39) missense probably damaging 1.00
IGL03109:Nelfb APN 2 25,091,073 (GRCm39) missense possibly damaging 0.95
IGL03255:Nelfb APN 2 25,093,207 (GRCm39) missense probably benign 0.21
R0541:Nelfb UTSW 2 25,093,992 (GRCm39) missense probably benign 0.01
R2046:Nelfb UTSW 2 25,096,323 (GRCm39) missense probably damaging 0.97
R4832:Nelfb UTSW 2 25,099,981 (GRCm39) missense probably damaging 1.00
R5299:Nelfb UTSW 2 25,100,757 (GRCm39) missense probably benign 0.20
R5663:Nelfb UTSW 2 25,093,501 (GRCm39) missense probably benign 0.01
R5854:Nelfb UTSW 2 25,100,005 (GRCm39) missense probably damaging 1.00
R5987:Nelfb UTSW 2 25,093,900 (GRCm39) missense probably damaging 1.00
R6747:Nelfb UTSW 2 25,093,393 (GRCm39) missense probably benign 0.09
R7025:Nelfb UTSW 2 25,100,505 (GRCm39) missense probably damaging 1.00
R8118:Nelfb UTSW 2 25,095,171 (GRCm39) missense possibly damaging 0.95
R8966:Nelfb UTSW 2 25,090,751 (GRCm39) missense probably damaging 1.00
R9001:Nelfb UTSW 2 25,096,287 (GRCm39) missense probably damaging 1.00
R9085:Nelfb UTSW 2 25,094,292 (GRCm39) missense probably damaging 1.00
R9373:Nelfb UTSW 2 25,095,218 (GRCm39) missense probably damaging 0.99
R9786:Nelfb UTSW 2 25,095,145 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCCACTTCCAGCTATAGAG -3'
(R):5'- CGTTTGTTTGTCATGCCCATAG -3'

Sequencing Primer
(F):5'- CCAGGTGTCTGAAGGACCTGTTC -3'
(R):5'- TCATGCCCATAGGTGGTGC -3'
Posted On 2016-05-10