Incidental Mutation 'R4995:Mga'
ID385151
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene NameMAX gene associated
SynonymsD030062C11Rik, Mga, Mad5, C130042M01Rik
MMRRC Submission 042589-MU
Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R4995 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location119897228-119969581 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 119932582 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1240 (R1240*)
Ref Sequence ENSEMBL: ENSMUSP00000119044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]
Predicted Effect probably null
Transcript: ENSMUST00000046717
AA Change: R1241*
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: R1241*

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079934
AA Change: R1240*
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: R1240*

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110773
AA Change: R1162*
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: R1162*

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110774
AA Change: R1241*
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: R1241*

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156074
Predicted Effect probably null
Transcript: ENSMUST00000156510
AA Change: R1240*
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943
AA Change: R1240*

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Meta Mutation Damage Score 0.9753 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,494,184 Q333* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acvrl1 G A 15: 101,135,860 R141H probably benign Het
Adprm A G 11: 67,041,610 F158L possibly damaging Het
Aldoart2 C T 12: 55,566,253 T321M probably benign Het
Ap3m2 A G 8: 22,803,776 V86A probably benign Het
Arhgef19 T A 4: 141,247,515 probably null Het
Armc4 G A 18: 7,223,663 T460M probably damaging Het
Bcl2l12 T G 7: 44,994,191 probably null Het
Bptf T C 11: 107,054,565 Q2501R probably damaging Het
C230029F24Rik A T 1: 49,338,136 noncoding transcript Het
C7 C T 15: 5,049,592 G78D probably damaging Het
Caly T C 7: 140,070,625 T135A probably benign Het
Cbl A G 9: 44,153,811 M740T possibly damaging Het
Cbx4 A G 11: 119,081,211 V446A probably benign Het
Celsr1 C A 15: 85,937,911 R1735L probably damaging Het
Cep250 A G 2: 155,988,316 D135G probably damaging Het
Cgn T C 3: 94,779,936 T19A probably damaging Het
Chic2 A T 5: 75,044,204 V32D probably damaging Het
Cntln A G 4: 85,049,883 K780E probably benign Het
Col8a2 A T 4: 126,310,788 D197V probably damaging Het
Crot A T 5: 8,974,000 V372E probably damaging Het
Cyb561d2 C T 9: 107,541,548 V26M probably damaging Het
Ddx5 G A 11: 106,785,236 T237I probably damaging Het
Dmxl2 G T 9: 54,501,441 probably benign Het
Dock8 T A 19: 25,158,383 S1188R probably benign Het
Ehbp1 T A 11: 22,101,073 H493L probably damaging Het
Eif5b T A 1: 38,051,711 *1217K probably null Het
Eprs A G 1: 185,410,139 probably benign Het
Etfdh T C 3: 79,605,788 D376G probably benign Het
Fam186a T C 15: 99,945,099 Q1088R probably benign Het
Fbxw16 G T 9: 109,441,250 T141N probably damaging Het
Fgf11 G A 11: 69,798,759 H138Y probably damaging Het
Gm1673 G A 5: 33,984,926 R79H probably damaging Het
Htra3 T C 5: 35,671,074 E154G probably damaging Het
Hydin T A 8: 110,569,642 V3601D probably damaging Het
Jup G T 11: 100,379,541 S380* probably null Het
Klrg1 T A 6: 122,278,275 D66V probably benign Het
Llgl1 C T 11: 60,709,724 A633V probably benign Het
Lmln T A 16: 33,074,097 Y203* probably null Het
Lrrc58 T G 16: 37,877,056 C165G probably benign Het
Lss T C 10: 76,547,537 V557A probably benign Het
Mast4 T C 13: 102,905,754 probably benign Het
Med13l C A 5: 118,730,949 P754Q possibly damaging Het
Mgat5b T A 11: 116,974,199 probably null Het
Mtor A G 4: 148,525,752 D1572G probably damaging Het
Muc4 T A 16: 32,754,214 S1363T probably benign Het
Muc4 T A 16: 32,754,041 S1306T probably benign Het
Myo18b A G 5: 112,760,392 V2005A probably damaging Het
Myo1e G A 9: 70,353,272 D571N probably benign Het
Mypn T C 10: 63,119,968 probably null Het
Ndufb10 T C 17: 24,722,757 probably null Het
Nelfb G T 2: 25,206,196 D300E probably benign Het
Olfr1389 T A 11: 49,430,655 Y60N probably damaging Het
Olfr1507 A T 14: 52,490,531 C61* probably null Het
Olfr625-ps1 T A 7: 103,683,367 D206E probably damaging Het
Olfr668 T A 7: 104,925,735 T10S probably benign Het
Pcdha11 C T 18: 37,011,027 T57M probably benign Het
Pkp1 A T 1: 135,880,855 I458N possibly damaging Het
Prr12 T A 7: 45,051,229 probably benign Het
Prrc2c A T 1: 162,705,310 probably benign Het
Psd4 T C 2: 24,397,247 F397S probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rfx1 T A 8: 84,080,114 probably null Het
Rsl1 A G 13: 67,182,249 T254A possibly damaging Het
Sh3rf3 A G 10: 59,086,824 Q574R probably benign Het
Spire1 T C 18: 67,552,779 probably null Het
St6galnac4 G A 2: 32,594,063 G91D probably damaging Het
Sytl2 T C 7: 90,382,257 probably benign Het
Tbpl2 T A 2: 24,093,860 K188N possibly damaging Het
Tenm3 A T 8: 48,229,137 M2486K possibly damaging Het
Tgoln1 A C 6: 72,616,140 V119G possibly damaging Het
Tpgs1 A T 10: 79,669,491 N28Y probably benign Het
U2surp A C 9: 95,462,794 probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Vmn2r19 A G 6: 123,329,910 N459S probably benign Het
Vmn2r72 T C 7: 85,738,485 S624G probably damaging Het
Vps13c A G 9: 67,919,321 T1415A probably benign Het
Vwa5b1 G A 4: 138,608,843 P147S probably damaging Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119919814 missense possibly damaging 0.65
IGL00719:Mga APN 2 119947453 nonsense probably null
IGL01619:Mga APN 2 119931828 missense possibly damaging 0.46
IGL01721:Mga APN 2 119935239 missense probably damaging 1.00
IGL01759:Mga APN 2 119951195 missense possibly damaging 0.92
IGL01785:Mga APN 2 119902912 missense probably damaging 1.00
IGL01786:Mga APN 2 119902912 missense probably damaging 1.00
IGL01950:Mga APN 2 119941654 missense possibly damaging 0.60
IGL01960:Mga APN 2 119938657 missense probably damaging 1.00
IGL02086:Mga APN 2 119924036 missense probably damaging 0.99
IGL02364:Mga APN 2 119964054 missense possibly damaging 0.66
IGL02602:Mga APN 2 119931884 missense possibly damaging 0.66
IGL02751:Mga APN 2 119947770 missense possibly damaging 0.82
IGL02794:Mga APN 2 119946289 missense possibly damaging 0.84
IGL03247:Mga APN 2 119935513 missense possibly damaging 0.81
IGL03303:Mga APN 2 119903452 missense probably damaging 1.00
PIT4515001:Mga UTSW 2 119916504 missense probably damaging 1.00
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0417:Mga UTSW 2 119902790 missense probably damaging 0.99
R0449:Mga UTSW 2 119941381 missense probably damaging 1.00
R0457:Mga UTSW 2 119916488 missense probably damaging 0.98
R0538:Mga UTSW 2 119919706 critical splice donor site probably null
R0568:Mga UTSW 2 119935422 missense probably damaging 1.00
R0614:Mga UTSW 2 119964466 missense probably damaging 1.00
R0671:Mga UTSW 2 119919910 splice site probably null
R0811:Mga UTSW 2 119947961 missense probably damaging 0.99
R0812:Mga UTSW 2 119947961 missense probably damaging 0.99
R0948:Mga UTSW 2 119941659 missense possibly damaging 0.77
R1177:Mga UTSW 2 119926446 missense probably damaging 1.00
R1445:Mga UTSW 2 119902698 missense probably damaging 1.00
R1476:Mga UTSW 2 119941675 missense probably damaging 0.96
R1527:Mga UTSW 2 119916597 missense probably damaging 1.00
R1583:Mga UTSW 2 119963960 missense possibly damaging 0.66
R1592:Mga UTSW 2 119964666 missense possibly damaging 0.93
R1627:Mga UTSW 2 119964562 missense probably damaging 1.00
R1658:Mga UTSW 2 119941689 missense possibly damaging 0.63
R1677:Mga UTSW 2 119960852 missense possibly damaging 0.92
R1887:Mga UTSW 2 119923617 missense probably damaging 1.00
R1908:Mga UTSW 2 119926594 missense possibly damaging 0.66
R1909:Mga UTSW 2 119926594 missense possibly damaging 0.66
R2061:Mga UTSW 2 119964980 unclassified probably benign
R2145:Mga UTSW 2 119964157 missense possibly damaging 0.85
R2159:Mga UTSW 2 119919643 missense probably damaging 0.96
R2179:Mga UTSW 2 119960442 missense probably damaging 0.99
R2281:Mga UTSW 2 119903723 missense probably benign
R2423:Mga UTSW 2 119964793 missense probably damaging 1.00
R3620:Mga UTSW 2 119916668 missense probably damaging 1.00
R3622:Mga UTSW 2 119941764 missense probably damaging 1.00
R3624:Mga UTSW 2 119941764 missense probably damaging 1.00
R3802:Mga UTSW 2 119947339 missense probably damaging 0.96
R4011:Mga UTSW 2 119931780 missense probably damaging 1.00
R4065:Mga UTSW 2 119947002 missense probably damaging 1.00
R4520:Mga UTSW 2 119948098 missense possibly damaging 0.85
R4649:Mga UTSW 2 119941493 missense possibly damaging 0.81
R4660:Mga UTSW 2 119938623 intron probably benign
R4757:Mga UTSW 2 119903639 missense possibly damaging 0.82
R4771:Mga UTSW 2 119964294 missense probably damaging 1.00
R4784:Mga UTSW 2 119903057 missense probably damaging 1.00
R4866:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4900:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4952:Mga UTSW 2 119903301 missense probably damaging 1.00
R5020:Mga UTSW 2 119951173 nonsense probably null
R5082:Mga UTSW 2 119903344 missense probably damaging 0.98
R5208:Mga UTSW 2 119947981 missense possibly damaging 0.83
R5454:Mga UTSW 2 119903329 missense probably damaging 0.99
R5466:Mga UTSW 2 119902697 missense probably damaging 1.00
R5484:Mga UTSW 2 119916626 missense possibly damaging 0.58
R5669:Mga UTSW 2 119903426 missense probably damaging 1.00
R5819:Mga UTSW 2 119941263 missense possibly damaging 0.61
R5916:Mga UTSW 2 119964312 missense probably benign 0.27
R5942:Mga UTSW 2 119946959 missense probably benign 0.41
R6305:Mga UTSW 2 119947698 missense probably benign 0.00
R6434:Mga UTSW 2 119923938 missense probably damaging 0.99
R6467:Mga UTSW 2 119946295 missense probably damaging 1.00
R6488:Mga UTSW 2 119960907 missense probably damaging 1.00
R6630:Mga UTSW 2 119923659 missense probably damaging 0.99
R6790:Mga UTSW 2 119923754 missense probably damaging 0.99
R7029:Mga UTSW 2 119923550 missense probably damaging 1.00
R7039:Mga UTSW 2 119932678 missense probably benign 0.28
R7088:Mga UTSW 2 119961936 missense probably damaging 1.00
R7195:Mga UTSW 2 119917328 missense probably damaging 1.00
R7273:Mga UTSW 2 119935214 missense probably damaging 1.00
R7286:Mga UTSW 2 119964788 missense possibly damaging 0.93
R7346:Mga UTSW 2 119935527 missense possibly damaging 0.56
R7383:Mga UTSW 2 119960340 missense probably damaging 0.99
R7469:Mga UTSW 2 119903046 missense probably damaging 1.00
R7484:Mga UTSW 2 119946229 missense probably damaging 0.99
R7537:Mga UTSW 2 119935551 missense probably damaging 0.97
R7781:Mga UTSW 2 119917357 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGAGTAATAATTGAAGATAGCC -3'
(R):5'- ACACAAAGATGATTACGGTGATAGT -3'

Sequencing Primer
(F):5'- ATCTCTGAGTTCAAGAGGTCTAGCC -3'
(R):5'- TGTAACACGGTTCTCAGG -3'
Posted On2016-05-10