Incidental Mutation 'R4995:Mga'
ID 385151
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene Name MAX gene associated
Synonyms Mga, C130042M01Rik, Mad5, D030062C11Rik
MMRRC Submission 042589-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.953) question?
Stock # R4995 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 119727709-119800062 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to T at 119763063 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 1240 (R1240*)
Ref Sequence ENSEMBL: ENSMUSP00000119044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000046717
AA Change: R1241*
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: R1241*

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079934
AA Change: R1240*
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: R1240*

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110773
AA Change: R1162*
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: R1162*

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110774
AA Change: R1241*
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: R1241*

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132054
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152148
Predicted Effect probably null
Transcript: ENSMUST00000156510
AA Change: R1240*
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943
AA Change: R1240*

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156074
Meta Mutation Damage Score 0.9753 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,498,995 (GRCm39) Q333* probably null Het
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Acvrl1 G A 15: 101,033,741 (GRCm39) R141H probably benign Het
Adprm A G 11: 66,932,436 (GRCm39) F158L possibly damaging Het
Aldoart2 C T 12: 55,613,038 (GRCm39) T321M probably benign Het
Ap3m2 A G 8: 23,293,792 (GRCm39) V86A probably benign Het
Arhgef19 T A 4: 140,974,826 (GRCm39) probably null Het
Bcl2l12 T G 7: 44,643,615 (GRCm39) probably null Het
Bptf T C 11: 106,945,391 (GRCm39) Q2501R probably damaging Het
C230029F24Rik A T 1: 49,377,295 (GRCm39) noncoding transcript Het
C7 C T 15: 5,079,074 (GRCm39) G78D probably damaging Het
Caly T C 7: 139,650,538 (GRCm39) T135A probably benign Het
Cbl A G 9: 44,065,108 (GRCm39) M740T possibly damaging Het
Cbx4 A G 11: 118,972,037 (GRCm39) V446A probably benign Het
Celsr1 C A 15: 85,822,112 (GRCm39) R1735L probably damaging Het
Cep250 A G 2: 155,830,236 (GRCm39) D135G probably damaging Het
Cgn T C 3: 94,687,246 (GRCm39) T19A probably damaging Het
Chic2 A T 5: 75,204,865 (GRCm39) V32D probably damaging Het
Cntln A G 4: 84,968,120 (GRCm39) K780E probably benign Het
Col8a2 A T 4: 126,204,581 (GRCm39) D197V probably damaging Het
Crot A T 5: 9,024,000 (GRCm39) V372E probably damaging Het
Cyb561d2 C T 9: 107,418,747 (GRCm39) V26M probably damaging Het
Ddx5 G A 11: 106,676,062 (GRCm39) T237I probably damaging Het
Dmxl2 G T 9: 54,408,725 (GRCm39) probably benign Het
Dock8 T A 19: 25,135,747 (GRCm39) S1188R probably benign Het
Ehbp1 T A 11: 22,051,073 (GRCm39) H493L probably damaging Het
Eif5b T A 1: 38,090,792 (GRCm39) *1217K probably null Het
Eprs1 A G 1: 185,142,336 (GRCm39) probably benign Het
Etfdh T C 3: 79,513,095 (GRCm39) D376G probably benign Het
Fam186a T C 15: 99,842,980 (GRCm39) Q1088R probably benign Het
Fbxw16 G T 9: 109,270,318 (GRCm39) T141N probably damaging Het
Fgf11 G A 11: 69,689,585 (GRCm39) H138Y probably damaging Het
Htra3 T C 5: 35,828,418 (GRCm39) E154G probably damaging Het
Hydin T A 8: 111,296,274 (GRCm39) V3601D probably damaging Het
Jup G T 11: 100,270,367 (GRCm39) S380* probably null Het
Klrg1 T A 6: 122,255,234 (GRCm39) D66V probably benign Het
Llgl1 C T 11: 60,600,550 (GRCm39) A633V probably benign Het
Lmln T A 16: 32,894,467 (GRCm39) Y203* probably null Het
Lrrc58 T G 16: 37,697,418 (GRCm39) C165G probably benign Het
Lss T C 10: 76,383,371 (GRCm39) V557A probably benign Het
Mast4 T C 13: 103,042,262 (GRCm39) probably benign Het
Med13l C A 5: 118,869,014 (GRCm39) P754Q possibly damaging Het
Mgat5b T A 11: 116,865,025 (GRCm39) probably null Het
Mtor A G 4: 148,610,209 (GRCm39) D1572G probably damaging Het
Muc4 T A 16: 32,754,214 (GRCm38) S1363T probably benign Het
Muc4 T A 16: 32,575,332 (GRCm39) S1306T probably benign Het
Myo18b A G 5: 112,908,258 (GRCm39) V2005A probably damaging Het
Myo1e G A 9: 70,260,554 (GRCm39) D571N probably benign Het
Mypn T C 10: 62,955,747 (GRCm39) probably null Het
Ndufb10 T C 17: 24,941,731 (GRCm39) probably null Het
Nelfb G T 2: 25,096,208 (GRCm39) D300E probably benign Het
Nicol1 G A 5: 34,142,270 (GRCm39) R79H probably damaging Het
Odad2 G A 18: 7,223,663 (GRCm39) T460M probably damaging Het
Or2y1d T A 11: 49,321,482 (GRCm39) Y60N probably damaging Het
Or4e5 A T 14: 52,727,988 (GRCm39) C61* probably null Het
Or52n2c T A 7: 104,574,942 (GRCm39) T10S probably benign Het
Or52z15 T A 7: 103,332,574 (GRCm39) D206E probably damaging Het
Pcdha11 C T 18: 37,144,080 (GRCm39) T57M probably benign Het
Pkp1 A T 1: 135,808,593 (GRCm39) I458N possibly damaging Het
Prr12 T A 7: 44,700,653 (GRCm39) probably benign Het
Prrc2c A T 1: 162,532,879 (GRCm39) probably benign Het
Psd4 T C 2: 24,287,259 (GRCm39) F397S probably benign Het
Pygm T C 19: 6,448,169 (GRCm39) I737T probably damaging Het
Rfx1 T A 8: 84,806,743 (GRCm39) probably null Het
Rsl1 A G 13: 67,330,313 (GRCm39) T254A possibly damaging Het
Sh3rf3 A G 10: 58,922,646 (GRCm39) Q574R probably benign Het
Spire1 T C 18: 67,685,849 (GRCm39) probably null Het
St6galnac4 G A 2: 32,484,075 (GRCm39) G91D probably damaging Het
Sytl2 T C 7: 90,031,465 (GRCm39) probably benign Het
Tbpl2 T A 2: 23,983,872 (GRCm39) K188N possibly damaging Het
Tenm3 A T 8: 48,682,172 (GRCm39) M2486K possibly damaging Het
Tgoln1 A C 6: 72,593,123 (GRCm39) V119G possibly damaging Het
Tpgs1 A T 10: 79,505,325 (GRCm39) N28Y probably benign Het
U2surp A C 9: 95,344,847 (GRCm39) probably benign Het
Vmn2r103 A G 17: 19,993,773 (GRCm39) H50R probably benign Het
Vmn2r19 A G 6: 123,306,869 (GRCm39) N459S probably benign Het
Vmn2r72 T C 7: 85,387,693 (GRCm39) S624G probably damaging Het
Vps13c A G 9: 67,826,603 (GRCm39) T1415A probably benign Het
Vwa5b1 G A 4: 138,336,154 (GRCm39) P147S probably damaging Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119,750,295 (GRCm39) missense possibly damaging 0.65
IGL00719:Mga APN 2 119,777,934 (GRCm39) nonsense probably null
IGL01619:Mga APN 2 119,762,309 (GRCm39) missense possibly damaging 0.46
IGL01721:Mga APN 2 119,765,720 (GRCm39) missense probably damaging 1.00
IGL01759:Mga APN 2 119,781,676 (GRCm39) missense possibly damaging 0.92
IGL01785:Mga APN 2 119,733,393 (GRCm39) missense probably damaging 1.00
IGL01786:Mga APN 2 119,733,393 (GRCm39) missense probably damaging 1.00
IGL01950:Mga APN 2 119,772,135 (GRCm39) missense possibly damaging 0.60
IGL01960:Mga APN 2 119,769,138 (GRCm39) missense probably damaging 1.00
IGL02086:Mga APN 2 119,754,517 (GRCm39) missense probably damaging 0.99
IGL02364:Mga APN 2 119,794,535 (GRCm39) missense possibly damaging 0.66
IGL02602:Mga APN 2 119,762,365 (GRCm39) missense possibly damaging 0.66
IGL02751:Mga APN 2 119,778,251 (GRCm39) missense possibly damaging 0.82
IGL02794:Mga APN 2 119,776,770 (GRCm39) missense possibly damaging 0.84
IGL03247:Mga APN 2 119,765,994 (GRCm39) missense possibly damaging 0.81
IGL03303:Mga APN 2 119,733,933 (GRCm39) missense probably damaging 1.00
PIT4515001:Mga UTSW 2 119,746,985 (GRCm39) missense probably damaging 1.00
R0060:Mga UTSW 2 119,791,442 (GRCm39) critical splice donor site probably null
R0060:Mga UTSW 2 119,791,442 (GRCm39) critical splice donor site probably null
R0417:Mga UTSW 2 119,733,271 (GRCm39) missense probably damaging 0.99
R0449:Mga UTSW 2 119,771,862 (GRCm39) missense probably damaging 1.00
R0457:Mga UTSW 2 119,746,969 (GRCm39) missense probably damaging 0.98
R0538:Mga UTSW 2 119,750,187 (GRCm39) critical splice donor site probably null
R0568:Mga UTSW 2 119,765,903 (GRCm39) missense probably damaging 1.00
R0614:Mga UTSW 2 119,794,947 (GRCm39) missense probably damaging 1.00
R0671:Mga UTSW 2 119,750,391 (GRCm39) splice site probably null
R0811:Mga UTSW 2 119,778,442 (GRCm39) missense probably damaging 0.99
R0812:Mga UTSW 2 119,778,442 (GRCm39) missense probably damaging 0.99
R0948:Mga UTSW 2 119,772,140 (GRCm39) missense possibly damaging 0.77
R1177:Mga UTSW 2 119,756,927 (GRCm39) missense probably damaging 1.00
R1445:Mga UTSW 2 119,733,179 (GRCm39) missense probably damaging 1.00
R1476:Mga UTSW 2 119,772,156 (GRCm39) missense probably damaging 0.96
R1527:Mga UTSW 2 119,747,078 (GRCm39) missense probably damaging 1.00
R1583:Mga UTSW 2 119,794,441 (GRCm39) missense possibly damaging 0.66
R1592:Mga UTSW 2 119,795,147 (GRCm39) missense possibly damaging 0.93
R1627:Mga UTSW 2 119,795,043 (GRCm39) missense probably damaging 1.00
R1658:Mga UTSW 2 119,772,170 (GRCm39) missense possibly damaging 0.63
R1677:Mga UTSW 2 119,791,333 (GRCm39) missense possibly damaging 0.92
R1887:Mga UTSW 2 119,754,098 (GRCm39) missense probably damaging 1.00
R1908:Mga UTSW 2 119,757,075 (GRCm39) missense possibly damaging 0.66
R1909:Mga UTSW 2 119,757,075 (GRCm39) missense possibly damaging 0.66
R2061:Mga UTSW 2 119,795,461 (GRCm39) unclassified probably benign
R2145:Mga UTSW 2 119,794,638 (GRCm39) missense possibly damaging 0.85
R2159:Mga UTSW 2 119,750,124 (GRCm39) missense probably damaging 0.96
R2179:Mga UTSW 2 119,790,923 (GRCm39) missense probably damaging 0.99
R2281:Mga UTSW 2 119,734,204 (GRCm39) missense probably benign
R2423:Mga UTSW 2 119,795,274 (GRCm39) missense probably damaging 1.00
R3620:Mga UTSW 2 119,747,149 (GRCm39) missense probably damaging 1.00
R3622:Mga UTSW 2 119,772,245 (GRCm39) missense probably damaging 1.00
R3624:Mga UTSW 2 119,772,245 (GRCm39) missense probably damaging 1.00
R3802:Mga UTSW 2 119,777,820 (GRCm39) missense probably damaging 0.96
R4011:Mga UTSW 2 119,762,261 (GRCm39) missense probably damaging 1.00
R4065:Mga UTSW 2 119,777,483 (GRCm39) missense probably damaging 1.00
R4520:Mga UTSW 2 119,778,579 (GRCm39) missense possibly damaging 0.85
R4649:Mga UTSW 2 119,771,974 (GRCm39) missense possibly damaging 0.81
R4660:Mga UTSW 2 119,769,104 (GRCm39) intron probably benign
R4757:Mga UTSW 2 119,734,120 (GRCm39) missense possibly damaging 0.82
R4771:Mga UTSW 2 119,794,775 (GRCm39) missense probably damaging 1.00
R4784:Mga UTSW 2 119,733,538 (GRCm39) missense probably damaging 1.00
R4866:Mga UTSW 2 119,794,535 (GRCm39) missense possibly damaging 0.66
R4900:Mga UTSW 2 119,794,535 (GRCm39) missense possibly damaging 0.66
R4952:Mga UTSW 2 119,733,782 (GRCm39) missense probably damaging 1.00
R5020:Mga UTSW 2 119,781,654 (GRCm39) nonsense probably null
R5082:Mga UTSW 2 119,733,825 (GRCm39) missense probably damaging 0.98
R5208:Mga UTSW 2 119,778,462 (GRCm39) missense possibly damaging 0.83
R5454:Mga UTSW 2 119,733,810 (GRCm39) missense probably damaging 0.99
R5466:Mga UTSW 2 119,733,178 (GRCm39) missense probably damaging 1.00
R5484:Mga UTSW 2 119,747,107 (GRCm39) missense possibly damaging 0.58
R5669:Mga UTSW 2 119,733,907 (GRCm39) missense probably damaging 1.00
R5819:Mga UTSW 2 119,771,744 (GRCm39) missense possibly damaging 0.61
R5916:Mga UTSW 2 119,794,793 (GRCm39) missense probably benign 0.27
R5942:Mga UTSW 2 119,777,440 (GRCm39) missense probably benign 0.41
R6305:Mga UTSW 2 119,778,179 (GRCm39) missense probably benign 0.00
R6434:Mga UTSW 2 119,754,419 (GRCm39) missense probably damaging 0.99
R6467:Mga UTSW 2 119,776,776 (GRCm39) missense probably damaging 1.00
R6488:Mga UTSW 2 119,791,388 (GRCm39) missense probably damaging 1.00
R6630:Mga UTSW 2 119,754,140 (GRCm39) missense probably damaging 0.99
R6790:Mga UTSW 2 119,754,235 (GRCm39) missense probably damaging 0.99
R7029:Mga UTSW 2 119,754,031 (GRCm39) missense probably damaging 1.00
R7039:Mga UTSW 2 119,763,159 (GRCm39) missense probably benign 0.28
R7088:Mga UTSW 2 119,792,417 (GRCm39) missense probably damaging 1.00
R7195:Mga UTSW 2 119,747,809 (GRCm39) missense probably damaging 1.00
R7273:Mga UTSW 2 119,765,695 (GRCm39) missense probably damaging 1.00
R7286:Mga UTSW 2 119,795,269 (GRCm39) missense possibly damaging 0.93
R7346:Mga UTSW 2 119,766,008 (GRCm39) missense possibly damaging 0.56
R7383:Mga UTSW 2 119,790,821 (GRCm39) missense probably damaging 0.99
R7469:Mga UTSW 2 119,733,527 (GRCm39) missense probably damaging 1.00
R7484:Mga UTSW 2 119,776,710 (GRCm39) missense probably damaging 0.99
R7537:Mga UTSW 2 119,766,032 (GRCm39) missense probably damaging 0.97
R7781:Mga UTSW 2 119,747,838 (GRCm39) missense probably damaging 1.00
R7921:Mga UTSW 2 119,750,159 (GRCm39) missense probably damaging 1.00
R8165:Mga UTSW 2 119,777,719 (GRCm39) missense probably benign 0.12
R8226:Mga UTSW 2 119,790,866 (GRCm39) missense probably benign 0.33
R8305:Mga UTSW 2 119,776,800 (GRCm39) missense possibly damaging 0.77
R8309:Mga UTSW 2 119,791,411 (GRCm39) missense probably damaging 1.00
R8363:Mga UTSW 2 119,794,407 (GRCm39) missense probably benign 0.43
R8388:Mga UTSW 2 119,794,562 (GRCm39) missense probably benign 0.00
R8524:Mga UTSW 2 119,771,997 (GRCm39) missense probably damaging 0.97
R8693:Mga UTSW 2 119,794,407 (GRCm39) missense possibly damaging 0.65
R8837:Mga UTSW 2 119,769,272 (GRCm39) splice site probably benign
R8916:Mga UTSW 2 119,788,819 (GRCm39) missense possibly damaging 0.92
R8936:Mga UTSW 2 119,794,709 (GRCm39) missense probably damaging 1.00
R9028:Mga UTSW 2 119,778,070 (GRCm39) missense probably benign
R9145:Mga UTSW 2 119,794,493 (GRCm39) missense probably benign
R9155:Mga UTSW 2 119,757,013 (GRCm39) missense probably damaging 1.00
R9308:Mga UTSW 2 119,754,369 (GRCm39) missense possibly damaging 0.91
R9342:Mga UTSW 2 119,778,656 (GRCm39) missense probably benign
R9347:Mga UTSW 2 119,733,518 (GRCm39) missense probably damaging 1.00
R9390:Mga UTSW 2 119,794,332 (GRCm39) missense probably damaging 0.99
R9408:Mga UTSW 2 119,765,999 (GRCm39) missense possibly damaging 0.92
R9488:Mga UTSW 2 119,795,304 (GRCm39) missense possibly damaging 0.90
R9495:Mga UTSW 2 119,781,676 (GRCm39) missense possibly damaging 0.92
R9521:Mga UTSW 2 119,794,979 (GRCm39) missense probably damaging 0.99
R9780:Mga UTSW 2 119,747,253 (GRCm39) missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TGCAGAGTAATAATTGAAGATAGCC -3'
(R):5'- ACACAAAGATGATTACGGTGATAGT -3'

Sequencing Primer
(F):5'- ATCTCTGAGTTCAAGAGGTCTAGCC -3'
(R):5'- TGTAACACGGTTCTCAGG -3'
Posted On 2016-05-10