Mutagenetix > Incidental Mutation

Incidental Mutation 'R4995:Cep250'

385153

Institutional Source

Beutler Lab

Gene Symbol

Cep250

Ensembl Gene

ENSMUSG00000038241

Gene Name

centrosomal protein 250

Synonyms

Cep2, Inmp, B230210E21Rik

MMRRC Submission

042589-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4995 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

155956458-155998900 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 155988316 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 135 (D135G)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039994] [ENSMUST00000094421] [ENSMUST00000109619] [ENSMUST00000124812] [ENSMUST00000128683]

AlphaFold

Q60952

Predicted Effect

probably damaging
Transcript: ENSMUST00000039994
AA Change: D1273G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241
AA Change: D1273G

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	4.2e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	327	N/A	INTRINSIC
internal_repeat_1	444	460	1.47e-18	PROSPERO
internal_repeat_1	465	481	1.47e-18	PROSPERO
low complexity region	495	506	N/A	INTRINSIC
low complexity region	557	580	N/A	INTRINSIC
low complexity region	583	595	N/A	INTRINSIC
low complexity region	635	650	N/A	INTRINSIC
low complexity region	669	677	N/A	INTRINSIC
low complexity region	688	703	N/A	INTRINSIC
low complexity region	708	719	N/A	INTRINSIC
low complexity region	896	914	N/A	INTRINSIC
low complexity region	990	1007	N/A	INTRINSIC
low complexity region	1043	1053	N/A	INTRINSIC
low complexity region	1138	1143	N/A	INTRINSIC
low complexity region	1182	1195	N/A	INTRINSIC
coiled coil region	1257	1687	N/A	INTRINSIC
low complexity region	1872	1895	N/A	INTRINSIC
low complexity region	1919	1933	N/A	INTRINSIC
low complexity region	1941	1960	N/A	INTRINSIC
internal_repeat_2	2002	2052	3.9e-6	PROSPERO
coiled coil region	2068	2169	N/A	INTRINSIC
coiled coil region	2196	2217	N/A	INTRINSIC
coiled coil region	2251	2310	N/A	INTRINSIC
low complexity region	2325	2338	N/A	INTRINSIC
coiled coil region	2340	2366	N/A	INTRINSIC
low complexity region	2379	2388	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000094421
AA Change: D1253G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241
AA Change: D1253G

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	215	5.4e-56	PFAM
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	357	N/A	INTRINSIC
coiled coil region	400	1165	N/A	INTRINSIC
coiled coil region	1237	1667	N/A	INTRINSIC
low complexity region	1852	1875	N/A	INTRINSIC
low complexity region	1899	1913	N/A	INTRINSIC
low complexity region	1921	1940	N/A	INTRINSIC
internal_repeat_1	1982	2032	3.35e-6	PROSPERO
coiled coil region	2048	2149	N/A	INTRINSIC
coiled coil region	2176	2197	N/A	INTRINSIC
coiled coil region	2231	2290	N/A	INTRINSIC
low complexity region	2305	2318	N/A	INTRINSIC
coiled coil region	2320	2346	N/A	INTRINSIC
low complexity region	2359	2368	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109619
AA Change: D1274G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241
AA Change: D1274G

Domain	Start	End	E-Value	Type
Pfam:Rootletin	38	214	4.1e-60	PFAM
low complexity region	215	225	N/A	INTRINSIC
low complexity region	228	241	N/A	INTRINSIC
coiled coil region	248	357	N/A	INTRINSIC
internal_repeat_1	445	461	1.51e-18	PROSPERO
internal_repeat_1	466	482	1.51e-18	PROSPERO
low complexity region	496	507	N/A	INTRINSIC
low complexity region	558	581	N/A	INTRINSIC
low complexity region	584	596	N/A	INTRINSIC
low complexity region	636	651	N/A	INTRINSIC
low complexity region	670	678	N/A	INTRINSIC
low complexity region	689	704	N/A	INTRINSIC
low complexity region	709	720	N/A	INTRINSIC
low complexity region	897	915	N/A	INTRINSIC
low complexity region	991	1008	N/A	INTRINSIC
low complexity region	1044	1054	N/A	INTRINSIC
low complexity region	1139	1144	N/A	INTRINSIC
low complexity region	1183	1196	N/A	INTRINSIC
coiled coil region	1258	1688	N/A	INTRINSIC
low complexity region	1873	1896	N/A	INTRINSIC
low complexity region	1920	1934	N/A	INTRINSIC
low complexity region	1942	1961	N/A	INTRINSIC
internal_repeat_2	2003	2053	3.95e-6	PROSPERO
coiled coil region	2069	2170	N/A	INTRINSIC
coiled coil region	2197	2218	N/A	INTRINSIC
coiled coil region	2252	2311	N/A	INTRINSIC
low complexity region	2326	2339	N/A	INTRINSIC
coiled coil region	2341	2367	N/A	INTRINSIC
low complexity region	2380	2389	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124812

Predicted Effect

probably benign
Transcript: ENSMUST00000128683

SMART Domains

Protein: ENSMUSP00000119845
Gene: ENSMUSG00000038241

Domain	Start	End	E-Value	Type
coiled coil region	2	37	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148191

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149905

Predicted Effect

probably damaging
Transcript: ENSMUST00000156355
AA Change: D135G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122223
Gene: ENSMUSG00000038241
AA Change: D135G

Domain	Start	End	E-Value	Type
coiled coil region	12	47	N/A	INTRINSIC
coiled coil region	119	223	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	G	A	2: 19,494,184	Q333*	probably null	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Acvrl1	G	A	15: 101,135,860	R141H	probably benign	Het
Adprm	A	G	11: 67,041,610	F158L	possibly damaging	Het
Aldoart2	C	T	12: 55,566,253	T321M	probably benign	Het
Ap3m2	A	G	8: 22,803,776	V86A	probably benign	Het
Arhgef19	T	A	4: 141,247,515		probably null	Het
Armc4	G	A	18: 7,223,663	T460M	probably damaging	Het
Bcl2l12	T	G	7: 44,994,191		probably null	Het
Bptf	T	C	11: 107,054,565	Q2501R	probably damaging	Het
C230029F24Rik	A	T	1: 49,338,136		noncoding transcript	Het
C7	C	T	15: 5,049,592	G78D	probably damaging	Het
Caly	T	C	7: 140,070,625	T135A	probably benign	Het
Cbl	A	G	9: 44,153,811	M740T	possibly damaging	Het
Cbx4	A	G	11: 119,081,211	V446A	probably benign	Het
Celsr1	C	A	15: 85,937,911	R1735L	probably damaging	Het
Cgn	T	C	3: 94,779,936	T19A	probably damaging	Het
Chic2	A	T	5: 75,044,204	V32D	probably damaging	Het
Cntln	A	G	4: 85,049,883	K780E	probably benign	Het
Col8a2	A	T	4: 126,310,788	D197V	probably damaging	Het
Crot	A	T	5: 8,974,000	V372E	probably damaging	Het
Cyb561d2	C	T	9: 107,541,548	V26M	probably damaging	Het
Ddx5	G	A	11: 106,785,236	T237I	probably damaging	Het
Dmxl2	G	T	9: 54,501,441		probably benign	Het
Dock8	T	A	19: 25,158,383	S1188R	probably benign	Het
Ehbp1	T	A	11: 22,101,073	H493L	probably damaging	Het
Eif5b	T	A	1: 38,051,711	*1217K	probably null	Het
Eprs	A	G	1: 185,410,139		probably benign	Het
Etfdh	T	C	3: 79,605,788	D376G	probably benign	Het
Fam186a	T	C	15: 99,945,099	Q1088R	probably benign	Het
Fbxw16	G	T	9: 109,441,250	T141N	probably damaging	Het
Fgf11	G	A	11: 69,798,759	H138Y	probably damaging	Het
Gm1673	G	A	5: 33,984,926	R79H	probably damaging	Het
Htra3	T	C	5: 35,671,074	E154G	probably damaging	Het
Hydin	T	A	8: 110,569,642	V3601D	probably damaging	Het
Jup	G	T	11: 100,379,541	S380*	probably null	Het
Klrg1	T	A	6: 122,278,275	D66V	probably benign	Het
Llgl1	C	T	11: 60,709,724	A633V	probably benign	Het
Lmln	T	A	16: 33,074,097	Y203*	probably null	Het
Lrrc58	T	G	16: 37,877,056	C165G	probably benign	Het
Lss	T	C	10: 76,547,537	V557A	probably benign	Het
Mast4	T	C	13: 102,905,754		probably benign	Het
Med13l	C	A	5: 118,730,949	P754Q	possibly damaging	Het
Mga	C	T	2: 119,932,582	R1240*	probably null	Het
Mgat5b	T	A	11: 116,974,199		probably null	Het
Mtor	A	G	4: 148,525,752	D1572G	probably damaging	Het
Muc4	T	A	16: 32,754,214	S1363T	probably benign	Het
Muc4	T	A	16: 32,754,041	S1306T	probably benign	Het
Myo18b	A	G	5: 112,760,392	V2005A	probably damaging	Het
Myo1e	G	A	9: 70,353,272	D571N	probably benign	Het
Mypn	T	C	10: 63,119,968		probably null	Het
Ndufb10	T	C	17: 24,722,757		probably null	Het
Nelfb	G	T	2: 25,206,196	D300E	probably benign	Het
Olfr1389	T	A	11: 49,430,655	Y60N	probably damaging	Het
Olfr1507	A	T	14: 52,490,531	C61*	probably null	Het
Olfr625-ps1	T	A	7: 103,683,367	D206E	probably damaging	Het
Olfr668	T	A	7: 104,925,735	T10S	probably benign	Het
Pcdha11	C	T	18: 37,011,027	T57M	probably benign	Het
Pkp1	A	T	1: 135,880,855	I458N	possibly damaging	Het
Prr12	T	A	7: 45,051,229		probably benign	Het
Prrc2c	A	T	1: 162,705,310		probably benign	Het
Psd4	T	C	2: 24,397,247	F397S	probably benign	Het
Pygm	T	C	19: 6,398,139	I737T	probably damaging	Het
Rfx1	T	A	8: 84,080,114		probably null	Het
Rsl1	A	G	13: 67,182,249	T254A	possibly damaging	Het
Sh3rf3	A	G	10: 59,086,824	Q574R	probably benign	Het
Spire1	T	C	18: 67,552,779		probably null	Het
St6galnac4	G	A	2: 32,594,063	G91D	probably damaging	Het
Sytl2	T	C	7: 90,382,257		probably benign	Het
Tbpl2	T	A	2: 24,093,860	K188N	possibly damaging	Het
Tenm3	A	T	8: 48,229,137	M2486K	possibly damaging	Het
Tgoln1	A	C	6: 72,616,140	V119G	possibly damaging	Het
Tpgs1	A	T	10: 79,669,491	N28Y	probably benign	Het
U2surp	A	C	9: 95,462,794		probably benign	Het
Vmn2r103	A	G	17: 19,773,511	H50R	probably benign	Het
Vmn2r19	A	G	6: 123,329,910	N459S	probably benign	Het
Vmn2r72	T	C	7: 85,738,485	S624G	probably damaging	Het
Vps13c	A	G	9: 67,919,321	T1415A	probably benign	Het
Vwa5b1	G	A	4: 138,608,843	P147S	probably damaging	Het

Other mutations in Cep250

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Cep250	APN	2	155991329	missense	probably benign	0.00
IGL01077:Cep250	APN	2	155962134	missense	probably damaging	1.00
IGL01084:Cep250	APN	2	155998393	missense	probably benign	0.00
IGL01400:Cep250	APN	2	155998291	missense	possibly damaging	0.78
IGL01570:Cep250	APN	2	155967663	splice site	probably benign
IGL01583:Cep250	APN	2	155976149	missense	probably damaging	0.99
IGL01590:Cep250	APN	2	155992317	missense	possibly damaging	0.80
IGL01647:Cep250	APN	2	155983376	missense	probably benign	0.02
IGL01959:Cep250	APN	2	155983359	missense	possibly damaging	0.63
IGL02066:Cep250	APN	2	155976521	missense	probably damaging	1.00
IGL02219:Cep250	APN	2	155991594	missense	probably benign	0.26
IGL02322:Cep250	APN	2	155990328	missense	probably damaging	1.00
IGL02728:Cep250	APN	2	155983278	unclassified	probably benign
IGL02955:Cep250	APN	2	155975756	missense	probably benign	0.01
IGL03369:Cep250	APN	2	155990271	missense	probably benign	0.00
R0366:Cep250	UTSW	2	155988401	missense	probably benign	0.00
R0403:Cep250	UTSW	2	155992349	missense	probably damaging	0.99
R0441:Cep250	UTSW	2	155972004	missense	possibly damaging	0.82
R0482:Cep250	UTSW	2	155964974	splice site	probably benign
R0507:Cep250	UTSW	2	155992532	missense	possibly damaging	0.60
R0614:Cep250	UTSW	2	155970097	nonsense	probably null
R0855:Cep250	UTSW	2	155964111	missense	probably damaging	1.00
R0973:Cep250	UTSW	2	155964289	splice site	probably benign
R1137:Cep250	UTSW	2	155990840	missense	probably benign	0.05
R1270:Cep250	UTSW	2	155990681	missense	probably benign	0.01
R1313:Cep250	UTSW	2	155972079	missense	probably damaging	0.98
R1313:Cep250	UTSW	2	155972079	missense	probably damaging	0.98
R1470:Cep250	UTSW	2	155991075	missense	probably damaging	0.99
R1470:Cep250	UTSW	2	155991075	missense	probably damaging	0.99
R1703:Cep250	UTSW	2	155965546	missense	probably benign	0.23
R1705:Cep250	UTSW	2	155963786	missense	probably damaging	1.00
R1740:Cep250	UTSW	2	155973356	missense	probably damaging	0.99
R1796:Cep250	UTSW	2	155992187	missense	possibly damaging	0.88
R1897:Cep250	UTSW	2	155976095	missense	probably damaging	1.00
R1900:Cep250	UTSW	2	155985374	critical splice donor site	probably null
R1958:Cep250	UTSW	2	155976381	splice site	probably null
R1974:Cep250	UTSW	2	155989504	missense	probably damaging	0.96
R2015:Cep250	UTSW	2	155981453	missense	probably damaging	0.96
R2033:Cep250	UTSW	2	155970892	missense	probably damaging	0.99
R2224:Cep250	UTSW	2	155991817	missense	possibly damaging	0.94
R2266:Cep250	UTSW	2	155976170	missense	probably benign	0.13
R2278:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2332:Cep250	UTSW	2	155990607	missense	probably damaging	1.00
R2364:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2366:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2367:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R2385:Cep250	UTSW	2	155974341	missense	probably damaging	1.00
R2830:Cep250	UTSW	2	155983316	missense	probably benign	0.00
R2895:Cep250	UTSW	2	155992122	missense	probably benign	0.00
R2965:Cep250	UTSW	2	155994878	missense	probably benign	0.44
R2966:Cep250	UTSW	2	155994878	missense	probably benign	0.44
R3016:Cep250	UTSW	2	155991288	missense	probably damaging	1.00
R3052:Cep250	UTSW	2	155991048	missense	probably damaging	0.99
R3424:Cep250	UTSW	2	155981461	missense	probably benign	0.02
R3930:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4085:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4087:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4088:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4090:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4110:Cep250	UTSW	2	155992632	missense	probably damaging	1.00
R4355:Cep250	UTSW	2	155991525	missense	probably damaging	1.00
R4601:Cep250	UTSW	2	155962053	missense	probably benign	0.10
R4721:Cep250	UTSW	2	155970199	missense	probably damaging	1.00
R5053:Cep250	UTSW	2	155962928	missense	possibly damaging	0.77
R5090:Cep250	UTSW	2	155976404	missense	probably damaging	1.00
R5744:Cep250	UTSW	2	155981474	missense	possibly damaging	0.60
R5775:Cep250	UTSW	2	155969374	missense	possibly damaging	0.92
R5986:Cep250	UTSW	2	155979277	missense	probably damaging	1.00
R6112:Cep250	UTSW	2	155994583	missense	possibly damaging	0.95
R6152:Cep250	UTSW	2	155981438	missense	possibly damaging	0.94
R6823:Cep250	UTSW	2	155981459	missense	probably benign	0.02
R6859:Cep250	UTSW	2	155992526	missense	probably benign	0.24
R6900:Cep250	UTSW	2	155996270	critical splice acceptor site	probably null
R7107:Cep250	UTSW	2	155995394	missense	probably benign	0.00
R7131:Cep250	UTSW	2	155965077	missense	probably damaging	1.00
R7178:Cep250	UTSW	2	155973455	nonsense	probably null
R7241:Cep250	UTSW	2	155991552	missense	probably benign	0.20
R7264:Cep250	UTSW	2	155979151	missense	probably damaging	0.99
R7290:Cep250	UTSW	2	155992762	missense	probably benign	0.03
R7367:Cep250	UTSW	2	155969307	missense	probably benign	0.00
R7397:Cep250	UTSW	2	155981411	missense	probably damaging	0.99
R7768:Cep250	UTSW	2	155986009	missense
R7823:Cep250	UTSW	2	155965416	missense	possibly damaging	0.89
R8152:Cep250	UTSW	2	155969307	missense	probably benign	0.00
R8331:Cep250	UTSW	2	155990253	missense	probably damaging	1.00
R8559:Cep250	UTSW	2	155992736	missense	probably damaging	0.99
R8972:Cep250	UTSW	2	155970122	missense	unknown
R8973:Cep250	UTSW	2	155970122	missense	unknown
R8974:Cep250	UTSW	2	155970122	missense	unknown
R8975:Cep250	UTSW	2	155970122	missense	unknown
R8976:Cep250	UTSW	2	155970122	missense	unknown
R9072:Cep250	UTSW	2	155992115	missense	probably benign	0.01
R9123:Cep250	UTSW	2	155970122	missense	unknown
R9127:Cep250	UTSW	2	155970122	missense	unknown
R9128:Cep250	UTSW	2	155970122	missense	unknown
R9167:Cep250	UTSW	2	155987000	missense
R9189:Cep250	UTSW	2	155976430	missense	probably benign	0.00
R9198:Cep250	UTSW	2	155988434	critical splice donor site	probably null
R9227:Cep250	UTSW	2	155970122	missense	unknown
R9228:Cep250	UTSW	2	155970122	missense	unknown
R9292:Cep250	UTSW	2	155990768	missense	probably damaging	0.99
R9516:Cep250	UTSW	2	155991539	missense	probably benign	0.00
R9723:Cep250	UTSW	2	155981417	missense	probably benign	0.00
R9760:Cep250	UTSW	2	155976553	missense	probably benign	0.02
X0061:Cep250	UTSW	2	155961985	missense	probably benign	0.05
Z1177:Cep250	UTSW	2	155976467	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- CCTTCAGGGAACTAAATGCAGAG -3'
(R):5'- TCGTAAAGGAGTTCACGAGGC -3'

Sequencing Primer
(F):5'- CAACATAATGTATGGTTGGGGTCACC -3'
(R):5'- TAAAGGAGTTCACGAGGCTCCATC -3'

Posted On

2016-05-10