Incidental Mutation 'R4995:Cep250'
ID 385153
Institutional Source Beutler Lab
Gene Symbol Cep250
Ensembl Gene ENSMUSG00000038241
Gene Name centrosomal protein 250
Synonyms B230210E21Rik, Cep2, Inmp
MMRRC Submission 042589-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4995 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 155798378-155840820 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 155830236 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 135 (D135G)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039994] [ENSMUST00000094421] [ENSMUST00000109619] [ENSMUST00000124812] [ENSMUST00000128683]
AlphaFold Q60952
Predicted Effect probably damaging
Transcript: ENSMUST00000039994
AA Change: D1273G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000038255
Gene: ENSMUSG00000038241
AA Change: D1273G

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 4.2e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 327 N/A INTRINSIC
internal_repeat_1 444 460 1.47e-18 PROSPERO
internal_repeat_1 465 481 1.47e-18 PROSPERO
low complexity region 495 506 N/A INTRINSIC
low complexity region 557 580 N/A INTRINSIC
low complexity region 583 595 N/A INTRINSIC
low complexity region 635 650 N/A INTRINSIC
low complexity region 669 677 N/A INTRINSIC
low complexity region 688 703 N/A INTRINSIC
low complexity region 708 719 N/A INTRINSIC
low complexity region 896 914 N/A INTRINSIC
low complexity region 990 1007 N/A INTRINSIC
low complexity region 1043 1053 N/A INTRINSIC
low complexity region 1138 1143 N/A INTRINSIC
low complexity region 1182 1195 N/A INTRINSIC
coiled coil region 1257 1687 N/A INTRINSIC
low complexity region 1872 1895 N/A INTRINSIC
low complexity region 1919 1933 N/A INTRINSIC
low complexity region 1941 1960 N/A INTRINSIC
internal_repeat_2 2002 2052 3.9e-6 PROSPERO
coiled coil region 2068 2169 N/A INTRINSIC
coiled coil region 2196 2217 N/A INTRINSIC
coiled coil region 2251 2310 N/A INTRINSIC
low complexity region 2325 2338 N/A INTRINSIC
coiled coil region 2340 2366 N/A INTRINSIC
low complexity region 2379 2388 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000094421
AA Change: D1253G

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091988
Gene: ENSMUSG00000038241
AA Change: D1253G

DomainStartEndE-ValueType
Pfam:Rootletin 38 215 5.4e-56 PFAM
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
coiled coil region 400 1165 N/A INTRINSIC
coiled coil region 1237 1667 N/A INTRINSIC
low complexity region 1852 1875 N/A INTRINSIC
low complexity region 1899 1913 N/A INTRINSIC
low complexity region 1921 1940 N/A INTRINSIC
internal_repeat_1 1982 2032 3.35e-6 PROSPERO
coiled coil region 2048 2149 N/A INTRINSIC
coiled coil region 2176 2197 N/A INTRINSIC
coiled coil region 2231 2290 N/A INTRINSIC
low complexity region 2305 2318 N/A INTRINSIC
coiled coil region 2320 2346 N/A INTRINSIC
low complexity region 2359 2368 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109619
AA Change: D1274G

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105248
Gene: ENSMUSG00000038241
AA Change: D1274G

DomainStartEndE-ValueType
Pfam:Rootletin 38 214 4.1e-60 PFAM
low complexity region 215 225 N/A INTRINSIC
low complexity region 228 241 N/A INTRINSIC
coiled coil region 248 357 N/A INTRINSIC
internal_repeat_1 445 461 1.51e-18 PROSPERO
internal_repeat_1 466 482 1.51e-18 PROSPERO
low complexity region 496 507 N/A INTRINSIC
low complexity region 558 581 N/A INTRINSIC
low complexity region 584 596 N/A INTRINSIC
low complexity region 636 651 N/A INTRINSIC
low complexity region 670 678 N/A INTRINSIC
low complexity region 689 704 N/A INTRINSIC
low complexity region 709 720 N/A INTRINSIC
low complexity region 897 915 N/A INTRINSIC
low complexity region 991 1008 N/A INTRINSIC
low complexity region 1044 1054 N/A INTRINSIC
low complexity region 1139 1144 N/A INTRINSIC
low complexity region 1183 1196 N/A INTRINSIC
coiled coil region 1258 1688 N/A INTRINSIC
low complexity region 1873 1896 N/A INTRINSIC
low complexity region 1920 1934 N/A INTRINSIC
low complexity region 1942 1961 N/A INTRINSIC
internal_repeat_2 2003 2053 3.95e-6 PROSPERO
coiled coil region 2069 2170 N/A INTRINSIC
coiled coil region 2197 2218 N/A INTRINSIC
coiled coil region 2252 2311 N/A INTRINSIC
low complexity region 2326 2339 N/A INTRINSIC
coiled coil region 2341 2367 N/A INTRINSIC
low complexity region 2380 2389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124812
Predicted Effect probably benign
Transcript: ENSMUST00000128683
SMART Domains Protein: ENSMUSP00000119845
Gene: ENSMUSG00000038241

DomainStartEndE-ValueType
coiled coil region 2 37 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149905
Predicted Effect probably damaging
Transcript: ENSMUST00000156355
AA Change: D135G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122223
Gene: ENSMUSG00000038241
AA Change: D135G

DomainStartEndE-ValueType
coiled coil region 12 47 N/A INTRINSIC
coiled coil region 119 223 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core centrosomal protein required for centriole-centriole cohesion during interphase of the cell cycle. The encoded protein dissociates from the centrosomes when parental centrioles separate at the beginning of mitosis. The protein associates with and is phosphorylated by NIMA-related kinase 2, which is also associated with the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,498,995 (GRCm39) Q333* probably null Het
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Acvrl1 G A 15: 101,033,741 (GRCm39) R141H probably benign Het
Adprm A G 11: 66,932,436 (GRCm39) F158L possibly damaging Het
Aldoart2 C T 12: 55,613,038 (GRCm39) T321M probably benign Het
Ap3m2 A G 8: 23,293,792 (GRCm39) V86A probably benign Het
Arhgef19 T A 4: 140,974,826 (GRCm39) probably null Het
Bcl2l12 T G 7: 44,643,615 (GRCm39) probably null Het
Bptf T C 11: 106,945,391 (GRCm39) Q2501R probably damaging Het
C230029F24Rik A T 1: 49,377,295 (GRCm39) noncoding transcript Het
C7 C T 15: 5,079,074 (GRCm39) G78D probably damaging Het
Caly T C 7: 139,650,538 (GRCm39) T135A probably benign Het
Cbl A G 9: 44,065,108 (GRCm39) M740T possibly damaging Het
Cbx4 A G 11: 118,972,037 (GRCm39) V446A probably benign Het
Celsr1 C A 15: 85,822,112 (GRCm39) R1735L probably damaging Het
Cgn T C 3: 94,687,246 (GRCm39) T19A probably damaging Het
Chic2 A T 5: 75,204,865 (GRCm39) V32D probably damaging Het
Cntln A G 4: 84,968,120 (GRCm39) K780E probably benign Het
Col8a2 A T 4: 126,204,581 (GRCm39) D197V probably damaging Het
Crot A T 5: 9,024,000 (GRCm39) V372E probably damaging Het
Cyb561d2 C T 9: 107,418,747 (GRCm39) V26M probably damaging Het
Ddx5 G A 11: 106,676,062 (GRCm39) T237I probably damaging Het
Dmxl2 G T 9: 54,408,725 (GRCm39) probably benign Het
Dock8 T A 19: 25,135,747 (GRCm39) S1188R probably benign Het
Ehbp1 T A 11: 22,051,073 (GRCm39) H493L probably damaging Het
Eif5b T A 1: 38,090,792 (GRCm39) *1217K probably null Het
Eprs1 A G 1: 185,142,336 (GRCm39) probably benign Het
Etfdh T C 3: 79,513,095 (GRCm39) D376G probably benign Het
Fam186a T C 15: 99,842,980 (GRCm39) Q1088R probably benign Het
Fbxw16 G T 9: 109,270,318 (GRCm39) T141N probably damaging Het
Fgf11 G A 11: 69,689,585 (GRCm39) H138Y probably damaging Het
Htra3 T C 5: 35,828,418 (GRCm39) E154G probably damaging Het
Hydin T A 8: 111,296,274 (GRCm39) V3601D probably damaging Het
Jup G T 11: 100,270,367 (GRCm39) S380* probably null Het
Klrg1 T A 6: 122,255,234 (GRCm39) D66V probably benign Het
Llgl1 C T 11: 60,600,550 (GRCm39) A633V probably benign Het
Lmln T A 16: 32,894,467 (GRCm39) Y203* probably null Het
Lrrc58 T G 16: 37,697,418 (GRCm39) C165G probably benign Het
Lss T C 10: 76,383,371 (GRCm39) V557A probably benign Het
Mast4 T C 13: 103,042,262 (GRCm39) probably benign Het
Med13l C A 5: 118,869,014 (GRCm39) P754Q possibly damaging Het
Mga C T 2: 119,763,063 (GRCm39) R1240* probably null Het
Mgat5b T A 11: 116,865,025 (GRCm39) probably null Het
Mtor A G 4: 148,610,209 (GRCm39) D1572G probably damaging Het
Muc4 T A 16: 32,754,214 (GRCm38) S1363T probably benign Het
Muc4 T A 16: 32,575,332 (GRCm39) S1306T probably benign Het
Myo18b A G 5: 112,908,258 (GRCm39) V2005A probably damaging Het
Myo1e G A 9: 70,260,554 (GRCm39) D571N probably benign Het
Mypn T C 10: 62,955,747 (GRCm39) probably null Het
Ndufb10 T C 17: 24,941,731 (GRCm39) probably null Het
Nelfb G T 2: 25,096,208 (GRCm39) D300E probably benign Het
Nicol1 G A 5: 34,142,270 (GRCm39) R79H probably damaging Het
Odad2 G A 18: 7,223,663 (GRCm39) T460M probably damaging Het
Or2y1d T A 11: 49,321,482 (GRCm39) Y60N probably damaging Het
Or4e5 A T 14: 52,727,988 (GRCm39) C61* probably null Het
Or52n2c T A 7: 104,574,942 (GRCm39) T10S probably benign Het
Or52z15 T A 7: 103,332,574 (GRCm39) D206E probably damaging Het
Pcdha11 C T 18: 37,144,080 (GRCm39) T57M probably benign Het
Pkp1 A T 1: 135,808,593 (GRCm39) I458N possibly damaging Het
Prr12 T A 7: 44,700,653 (GRCm39) probably benign Het
Prrc2c A T 1: 162,532,879 (GRCm39) probably benign Het
Psd4 T C 2: 24,287,259 (GRCm39) F397S probably benign Het
Pygm T C 19: 6,448,169 (GRCm39) I737T probably damaging Het
Rfx1 T A 8: 84,806,743 (GRCm39) probably null Het
Rsl1 A G 13: 67,330,313 (GRCm39) T254A possibly damaging Het
Sh3rf3 A G 10: 58,922,646 (GRCm39) Q574R probably benign Het
Spire1 T C 18: 67,685,849 (GRCm39) probably null Het
St6galnac4 G A 2: 32,484,075 (GRCm39) G91D probably damaging Het
Sytl2 T C 7: 90,031,465 (GRCm39) probably benign Het
Tbpl2 T A 2: 23,983,872 (GRCm39) K188N possibly damaging Het
Tenm3 A T 8: 48,682,172 (GRCm39) M2486K possibly damaging Het
Tgoln1 A C 6: 72,593,123 (GRCm39) V119G possibly damaging Het
Tpgs1 A T 10: 79,505,325 (GRCm39) N28Y probably benign Het
U2surp A C 9: 95,344,847 (GRCm39) probably benign Het
Vmn2r103 A G 17: 19,993,773 (GRCm39) H50R probably benign Het
Vmn2r19 A G 6: 123,306,869 (GRCm39) N459S probably benign Het
Vmn2r72 T C 7: 85,387,693 (GRCm39) S624G probably damaging Het
Vps13c A G 9: 67,826,603 (GRCm39) T1415A probably benign Het
Vwa5b1 G A 4: 138,336,154 (GRCm39) P147S probably damaging Het
Other mutations in Cep250
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Cep250 APN 2 155,833,249 (GRCm39) missense probably benign 0.00
IGL01077:Cep250 APN 2 155,804,054 (GRCm39) missense probably damaging 1.00
IGL01084:Cep250 APN 2 155,840,313 (GRCm39) missense probably benign 0.00
IGL01400:Cep250 APN 2 155,840,211 (GRCm39) missense possibly damaging 0.78
IGL01570:Cep250 APN 2 155,809,583 (GRCm39) splice site probably benign
IGL01583:Cep250 APN 2 155,818,069 (GRCm39) missense probably damaging 0.99
IGL01590:Cep250 APN 2 155,834,237 (GRCm39) missense possibly damaging 0.80
IGL01647:Cep250 APN 2 155,825,296 (GRCm39) missense probably benign 0.02
IGL01959:Cep250 APN 2 155,825,279 (GRCm39) missense possibly damaging 0.63
IGL02066:Cep250 APN 2 155,818,441 (GRCm39) missense probably damaging 1.00
IGL02219:Cep250 APN 2 155,833,514 (GRCm39) missense probably benign 0.26
IGL02322:Cep250 APN 2 155,832,248 (GRCm39) missense probably damaging 1.00
IGL02728:Cep250 APN 2 155,825,198 (GRCm39) unclassified probably benign
IGL02955:Cep250 APN 2 155,817,676 (GRCm39) missense probably benign 0.01
IGL03369:Cep250 APN 2 155,832,191 (GRCm39) missense probably benign 0.00
R0366:Cep250 UTSW 2 155,830,321 (GRCm39) missense probably benign 0.00
R0403:Cep250 UTSW 2 155,834,269 (GRCm39) missense probably damaging 0.99
R0441:Cep250 UTSW 2 155,813,924 (GRCm39) missense possibly damaging 0.82
R0482:Cep250 UTSW 2 155,806,894 (GRCm39) splice site probably benign
R0507:Cep250 UTSW 2 155,834,452 (GRCm39) missense possibly damaging 0.60
R0614:Cep250 UTSW 2 155,812,017 (GRCm39) nonsense probably null
R0855:Cep250 UTSW 2 155,806,031 (GRCm39) missense probably damaging 1.00
R0973:Cep250 UTSW 2 155,806,209 (GRCm39) splice site probably benign
R1137:Cep250 UTSW 2 155,832,760 (GRCm39) missense probably benign 0.05
R1270:Cep250 UTSW 2 155,832,601 (GRCm39) missense probably benign 0.01
R1313:Cep250 UTSW 2 155,813,999 (GRCm39) missense probably damaging 0.98
R1313:Cep250 UTSW 2 155,813,999 (GRCm39) missense probably damaging 0.98
R1470:Cep250 UTSW 2 155,832,995 (GRCm39) missense probably damaging 0.99
R1470:Cep250 UTSW 2 155,832,995 (GRCm39) missense probably damaging 0.99
R1703:Cep250 UTSW 2 155,807,466 (GRCm39) missense probably benign 0.23
R1705:Cep250 UTSW 2 155,805,706 (GRCm39) missense probably damaging 1.00
R1740:Cep250 UTSW 2 155,815,276 (GRCm39) missense probably damaging 0.99
R1796:Cep250 UTSW 2 155,834,107 (GRCm39) missense possibly damaging 0.88
R1897:Cep250 UTSW 2 155,818,015 (GRCm39) missense probably damaging 1.00
R1900:Cep250 UTSW 2 155,827,294 (GRCm39) critical splice donor site probably null
R1958:Cep250 UTSW 2 155,818,301 (GRCm39) splice site probably null
R1974:Cep250 UTSW 2 155,831,424 (GRCm39) missense probably damaging 0.96
R2015:Cep250 UTSW 2 155,823,373 (GRCm39) missense probably damaging 0.96
R2033:Cep250 UTSW 2 155,812,812 (GRCm39) missense probably damaging 0.99
R2224:Cep250 UTSW 2 155,833,737 (GRCm39) missense possibly damaging 0.94
R2266:Cep250 UTSW 2 155,818,090 (GRCm39) missense probably benign 0.13
R2278:Cep250 UTSW 2 155,834,552 (GRCm39) missense probably damaging 1.00
R2332:Cep250 UTSW 2 155,832,527 (GRCm39) missense probably damaging 1.00
R2364:Cep250 UTSW 2 155,834,552 (GRCm39) missense probably damaging 1.00
R2366:Cep250 UTSW 2 155,834,552 (GRCm39) missense probably damaging 1.00
R2367:Cep250 UTSW 2 155,834,552 (GRCm39) missense probably damaging 1.00
R2385:Cep250 UTSW 2 155,816,261 (GRCm39) missense probably damaging 1.00
R2830:Cep250 UTSW 2 155,825,236 (GRCm39) missense probably benign 0.00
R2895:Cep250 UTSW 2 155,834,042 (GRCm39) missense probably benign 0.00
R2965:Cep250 UTSW 2 155,836,798 (GRCm39) missense probably benign 0.44
R2966:Cep250 UTSW 2 155,836,798 (GRCm39) missense probably benign 0.44
R3016:Cep250 UTSW 2 155,833,208 (GRCm39) missense probably damaging 1.00
R3052:Cep250 UTSW 2 155,832,968 (GRCm39) missense probably damaging 0.99
R3424:Cep250 UTSW 2 155,823,381 (GRCm39) missense probably benign 0.02
R3930:Cep250 UTSW 2 155,834,552 (GRCm39) missense probably damaging 1.00
R4085:Cep250 UTSW 2 155,834,552 (GRCm39) missense probably damaging 1.00
R4087:Cep250 UTSW 2 155,834,552 (GRCm39) missense probably damaging 1.00
R4088:Cep250 UTSW 2 155,834,552 (GRCm39) missense probably damaging 1.00
R4090:Cep250 UTSW 2 155,834,552 (GRCm39) missense probably damaging 1.00
R4110:Cep250 UTSW 2 155,834,552 (GRCm39) missense probably damaging 1.00
R4355:Cep250 UTSW 2 155,833,445 (GRCm39) missense probably damaging 1.00
R4601:Cep250 UTSW 2 155,803,973 (GRCm39) missense probably benign 0.10
R4721:Cep250 UTSW 2 155,812,119 (GRCm39) missense probably damaging 1.00
R5053:Cep250 UTSW 2 155,804,848 (GRCm39) missense possibly damaging 0.77
R5090:Cep250 UTSW 2 155,818,324 (GRCm39) missense probably damaging 1.00
R5744:Cep250 UTSW 2 155,823,394 (GRCm39) missense possibly damaging 0.60
R5775:Cep250 UTSW 2 155,811,294 (GRCm39) missense possibly damaging 0.92
R5986:Cep250 UTSW 2 155,821,197 (GRCm39) missense probably damaging 1.00
R6112:Cep250 UTSW 2 155,836,503 (GRCm39) missense possibly damaging 0.95
R6152:Cep250 UTSW 2 155,823,358 (GRCm39) missense possibly damaging 0.94
R6823:Cep250 UTSW 2 155,823,379 (GRCm39) missense probably benign 0.02
R6859:Cep250 UTSW 2 155,834,446 (GRCm39) missense probably benign 0.24
R6900:Cep250 UTSW 2 155,838,190 (GRCm39) critical splice acceptor site probably null
R7107:Cep250 UTSW 2 155,837,314 (GRCm39) missense probably benign 0.00
R7131:Cep250 UTSW 2 155,806,997 (GRCm39) missense probably damaging 1.00
R7178:Cep250 UTSW 2 155,815,375 (GRCm39) nonsense probably null
R7241:Cep250 UTSW 2 155,833,472 (GRCm39) missense probably benign 0.20
R7264:Cep250 UTSW 2 155,821,071 (GRCm39) missense probably damaging 0.99
R7290:Cep250 UTSW 2 155,834,682 (GRCm39) missense probably benign 0.03
R7367:Cep250 UTSW 2 155,811,227 (GRCm39) missense probably benign 0.00
R7397:Cep250 UTSW 2 155,823,331 (GRCm39) missense probably damaging 0.99
R7768:Cep250 UTSW 2 155,827,929 (GRCm39) missense
R7823:Cep250 UTSW 2 155,807,336 (GRCm39) missense possibly damaging 0.89
R8152:Cep250 UTSW 2 155,811,227 (GRCm39) missense probably benign 0.00
R8331:Cep250 UTSW 2 155,832,173 (GRCm39) missense probably damaging 1.00
R8559:Cep250 UTSW 2 155,834,656 (GRCm39) missense probably damaging 0.99
R8972:Cep250 UTSW 2 155,812,042 (GRCm39) missense unknown
R8973:Cep250 UTSW 2 155,812,042 (GRCm39) missense unknown
R8974:Cep250 UTSW 2 155,812,042 (GRCm39) missense unknown
R8975:Cep250 UTSW 2 155,812,042 (GRCm39) missense unknown
R8976:Cep250 UTSW 2 155,812,042 (GRCm39) missense unknown
R9072:Cep250 UTSW 2 155,834,035 (GRCm39) missense probably benign 0.01
R9123:Cep250 UTSW 2 155,812,042 (GRCm39) missense unknown
R9127:Cep250 UTSW 2 155,812,042 (GRCm39) missense unknown
R9128:Cep250 UTSW 2 155,812,042 (GRCm39) missense unknown
R9167:Cep250 UTSW 2 155,828,920 (GRCm39) missense
R9189:Cep250 UTSW 2 155,818,350 (GRCm39) missense probably benign 0.00
R9198:Cep250 UTSW 2 155,830,354 (GRCm39) critical splice donor site probably null
R9227:Cep250 UTSW 2 155,812,042 (GRCm39) missense unknown
R9228:Cep250 UTSW 2 155,812,042 (GRCm39) missense unknown
R9292:Cep250 UTSW 2 155,832,688 (GRCm39) missense probably damaging 0.99
R9516:Cep250 UTSW 2 155,833,459 (GRCm39) missense probably benign 0.00
R9723:Cep250 UTSW 2 155,823,337 (GRCm39) missense probably benign 0.00
R9760:Cep250 UTSW 2 155,818,473 (GRCm39) missense probably benign 0.02
X0061:Cep250 UTSW 2 155,803,905 (GRCm39) missense probably benign 0.05
Z1177:Cep250 UTSW 2 155,818,387 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CCTTCAGGGAACTAAATGCAGAG -3'
(R):5'- TCGTAAAGGAGTTCACGAGGC -3'

Sequencing Primer
(F):5'- CAACATAATGTATGGTTGGGGTCACC -3'
(R):5'- TAAAGGAGTTCACGAGGCTCCATC -3'
Posted On 2016-05-10