Incidental Mutation 'R0374:Fosb'
ID38516
Institutional Source Beutler Lab
Gene Symbol Fosb
Ensembl Gene ENSMUSG00000003545
Gene NameFBJ osteosarcoma oncogene B
Synonyms
MMRRC Submission 038580-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0374 (G1)
Quality Score170
Status Validated
Chromosome7
Chromosomal Location19302696-19310051 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 19307150 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 139 (R139S)
Ref Sequence ENSEMBL: ENSMUSP00000146789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003640] [ENSMUST00000207334] [ENSMUST00000207716] [ENSMUST00000208326] [ENSMUST00000208446] [ENSMUST00000208505]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003640
AA Change: R139S

PolyPhen 2 Score 0.692 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000003640
Gene: ENSMUSG00000003545
AA Change: R139S

DomainStartEndE-ValueType
low complexity region 113 132 N/A INTRINSIC
BRLZ 153 217 5.58e-13 SMART
low complexity region 255 265 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207334
AA Change: R139S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably damaging
Transcript: ENSMUST00000207716
AA Change: R100S

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208230
Predicted Effect probably damaging
Transcript: ENSMUST00000208326
AA Change: R100S

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000208446
AA Change: R139S

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208505
AA Change: R139S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fos gene family consists of 4 members: FOS, FOSB, FOSL1, and FOSL2. These genes encode leucine zipper proteins that can dimerize with proteins of the JUN family, thereby forming the transcription factor complex AP-1. As such, the FOS proteins have been implicated as regulators of cell proliferation, differentiation, and transformation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show impaired nurturing behavior, altered behavioral tolerance to repeated motor seizures, reduced NMDA-mediated synaptic currents, and altered paradoxical sleep. Aging mice homozygous for another null allele may exhibit occasional tonic-clonic or generalized seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,248,961 C178S probably damaging Het
Ano9 A G 7: 141,107,814 I267T probably damaging Het
Anxa6 T A 11: 55,005,828 N168I probably benign Het
Apbb1ip A G 2: 22,819,705 probably benign Het
Aqr G A 2: 114,130,611 H723Y probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Car13 A G 3: 14,656,297 probably benign Het
Casp9 T A 4: 141,807,173 I298N possibly damaging Het
Ccdc66 T C 14: 27,498,473 E261G probably damaging Het
Cep192 T A 18: 67,818,883 Y376* probably null Het
Cped1 T A 6: 22,222,546 probably benign Het
Ctbp2 A T 7: 132,999,344 S563R possibly damaging Het
Ctdp1 A G 18: 80,447,422 probably null Het
Dgka G C 10: 128,721,083 probably benign Het
Drd2 A G 9: 49,399,784 T112A probably benign Het
Dusp1 A G 17: 26,508,169 V52A probably damaging Het
Eea1 T A 10: 96,039,772 probably benign Het
Etfrf1 T C 6: 145,215,562 V86A probably benign Het
Fbn1 A T 2: 125,321,676 C2087S possibly damaging Het
Foxm1 C T 6: 128,372,603 R362W probably damaging Het
Frem2 A G 3: 53,653,960 V1042A probably damaging Het
Gbe1 A G 16: 70,483,914 H401R probably benign Het
Gm10549 C T 18: 33,464,182 probably benign Het
Golga7b A T 19: 42,263,319 probably benign Het
H2-DMb1 T C 17: 34,159,425 V235A probably benign Het
Hr A G 14: 70,556,476 T59A probably benign Het
Itpr2 C A 6: 146,359,392 A588S probably benign Het
Kmt2c G A 5: 25,309,708 P3046S probably damaging Het
Lamc1 G A 1: 153,251,065 probably benign Het
Lrp2 A G 2: 69,430,307 Y4527H probably damaging Het
Map3k2 G A 18: 32,212,173 probably null Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Nfs1 C G 2: 156,132,660 G212R probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nrap T A 19: 56,351,622 Y740F probably damaging Het
Nup205 T A 6: 35,208,837 M859K probably damaging Het
Nxf1 T C 19: 8,767,739 F451S possibly damaging Het
Olfr262 A T 19: 12,241,141 N173K probably damaging Het
Olfr804 G A 10: 129,705,647 M256I probably benign Het
Pcdhac2 T C 18: 37,145,667 Y567H probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pi4ka A G 16: 17,282,932 probably benign Het
Pmpcb A G 5: 21,748,831 D359G probably damaging Het
Poll T G 19: 45,557,870 S244R probably benign Het
Prkd3 T C 17: 78,957,215 D657G probably null Het
Prune2 G A 19: 17,120,910 M1259I probably benign Het
Ptpra T A 2: 130,537,621 M329K probably damaging Het
Rbm10 GGGAGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG GGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG X: 20,637,559 probably benign Het
Rbm15 G T 3: 107,330,564 D839E probably damaging Het
Sap30bp T A 11: 115,964,277 I271N probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setdb1 A T 3: 95,324,853 probably benign Het
Sgk3 T A 1: 9,879,081 probably null Het
Shox2 A T 3: 66,973,851 H265Q probably damaging Het
Slc9a2 T C 1: 40,743,857 F427S possibly damaging Het
Smarca5 T A 8: 80,736,731 Q69H probably benign Het
Specc1l T A 10: 75,248,459 F672Y probably damaging Het
Ssh2 T A 11: 77,408,143 S105R probably damaging Het
Syne2 C T 12: 75,921,226 R917* probably null Het
Tbc1d2 G A 4: 46,649,913 T41M possibly damaging Het
Tbx18 T A 9: 87,724,355 I246F probably damaging Het
Tcf4 T A 18: 69,681,812 probably benign Het
Tmed2 C A 5: 124,541,439 probably null Het
Tmem243 A T 5: 9,101,361 D15V possibly damaging Het
Vmn2r87 T A 10: 130,471,979 S797C probably damaging Het
Vps13c T A 9: 67,886,246 probably benign Het
Wls T A 3: 159,897,437 C162* probably null Het
Zbtb7c C T 18: 76,137,393 T184I probably benign Het
Zc3h13 A G 14: 75,308,965 K169E probably damaging Het
Other mutations in Fosb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Fosb APN 7 19307114 splice site probably null
R0183:Fosb UTSW 7 19307385 missense probably damaging 0.99
R0555:Fosb UTSW 7 19307213 missense possibly damaging 0.84
R2329:Fosb UTSW 7 19307185 missense probably benign
R3498:Fosb UTSW 7 19306632 missense probably damaging 1.00
R4064:Fosb UTSW 7 19305192 nonsense probably null
R4790:Fosb UTSW 7 19309388 missense probably damaging 1.00
R6327:Fosb UTSW 7 19307227 missense probably benign
R6605:Fosb UTSW 7 19309358 missense probably damaging 1.00
R7282:Fosb UTSW 7 19305188 missense possibly damaging 0.62
R7444:Fosb UTSW 7 19307274 missense possibly damaging 0.86
R7764:Fosb UTSW 7 19305046 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- GGCCAGAATGGTAAAGTTCCTTCAGAC -3'
(R):5'- ATCTTCAGTGGCTCGTGCAACC -3'

Sequencing Primer
(F):5'- ctcctgctcctcctgcc -3'
(R):5'- GTGCAACCCACCCTCATCTC -3'
Posted On2013-05-23