Incidental Mutation 'R4995:Tgoln1'
ID 385167
Institutional Source Beutler Lab
Gene Symbol Tgoln1
Ensembl Gene ENSMUSG00000056429
Gene Name trans-golgi network protein
Synonyms TGN38A, Ttgn1, D6Ertd384e, TGN38
MMRRC Submission 042589-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.130) question?
Stock # R4995 (G1)
Quality Score 225
Status Validated
Chromosome 6
Chromosomal Location 72585415-72593983 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 72593123 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 119 (V119G)
Ref Sequence ENSEMBL: ENSMUSP00000068487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070524]
AlphaFold Q62313
Predicted Effect possibly damaging
Transcript: ENSMUST00000070524
AA Change: V119G

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068487
Gene: ENSMUSG00000056429
AA Change: V119G

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 58 74 N/A INTRINSIC
low complexity region 238 260 N/A INTRINSIC
transmembrane domain 300 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172588
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,498,995 (GRCm39) Q333* probably null Het
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Acvrl1 G A 15: 101,033,741 (GRCm39) R141H probably benign Het
Adprm A G 11: 66,932,436 (GRCm39) F158L possibly damaging Het
Aldoart2 C T 12: 55,613,038 (GRCm39) T321M probably benign Het
Ap3m2 A G 8: 23,293,792 (GRCm39) V86A probably benign Het
Arhgef19 T A 4: 140,974,826 (GRCm39) probably null Het
Bcl2l12 T G 7: 44,643,615 (GRCm39) probably null Het
Bptf T C 11: 106,945,391 (GRCm39) Q2501R probably damaging Het
C230029F24Rik A T 1: 49,377,295 (GRCm39) noncoding transcript Het
C7 C T 15: 5,079,074 (GRCm39) G78D probably damaging Het
Caly T C 7: 139,650,538 (GRCm39) T135A probably benign Het
Cbl A G 9: 44,065,108 (GRCm39) M740T possibly damaging Het
Cbx4 A G 11: 118,972,037 (GRCm39) V446A probably benign Het
Celsr1 C A 15: 85,822,112 (GRCm39) R1735L probably damaging Het
Cep250 A G 2: 155,830,236 (GRCm39) D135G probably damaging Het
Cgn T C 3: 94,687,246 (GRCm39) T19A probably damaging Het
Chic2 A T 5: 75,204,865 (GRCm39) V32D probably damaging Het
Cntln A G 4: 84,968,120 (GRCm39) K780E probably benign Het
Col8a2 A T 4: 126,204,581 (GRCm39) D197V probably damaging Het
Crot A T 5: 9,024,000 (GRCm39) V372E probably damaging Het
Cyb561d2 C T 9: 107,418,747 (GRCm39) V26M probably damaging Het
Ddx5 G A 11: 106,676,062 (GRCm39) T237I probably damaging Het
Dmxl2 G T 9: 54,408,725 (GRCm39) probably benign Het
Dock8 T A 19: 25,135,747 (GRCm39) S1188R probably benign Het
Ehbp1 T A 11: 22,051,073 (GRCm39) H493L probably damaging Het
Eif5b T A 1: 38,090,792 (GRCm39) *1217K probably null Het
Eprs1 A G 1: 185,142,336 (GRCm39) probably benign Het
Etfdh T C 3: 79,513,095 (GRCm39) D376G probably benign Het
Fam186a T C 15: 99,842,980 (GRCm39) Q1088R probably benign Het
Fbxw16 G T 9: 109,270,318 (GRCm39) T141N probably damaging Het
Fgf11 G A 11: 69,689,585 (GRCm39) H138Y probably damaging Het
Htra3 T C 5: 35,828,418 (GRCm39) E154G probably damaging Het
Hydin T A 8: 111,296,274 (GRCm39) V3601D probably damaging Het
Jup G T 11: 100,270,367 (GRCm39) S380* probably null Het
Klrg1 T A 6: 122,255,234 (GRCm39) D66V probably benign Het
Llgl1 C T 11: 60,600,550 (GRCm39) A633V probably benign Het
Lmln T A 16: 32,894,467 (GRCm39) Y203* probably null Het
Lrrc58 T G 16: 37,697,418 (GRCm39) C165G probably benign Het
Lss T C 10: 76,383,371 (GRCm39) V557A probably benign Het
Mast4 T C 13: 103,042,262 (GRCm39) probably benign Het
Med13l C A 5: 118,869,014 (GRCm39) P754Q possibly damaging Het
Mga C T 2: 119,763,063 (GRCm39) R1240* probably null Het
Mgat5b T A 11: 116,865,025 (GRCm39) probably null Het
Mtor A G 4: 148,610,209 (GRCm39) D1572G probably damaging Het
Muc4 T A 16: 32,754,214 (GRCm38) S1363T probably benign Het
Muc4 T A 16: 32,575,332 (GRCm39) S1306T probably benign Het
Myo18b A G 5: 112,908,258 (GRCm39) V2005A probably damaging Het
Myo1e G A 9: 70,260,554 (GRCm39) D571N probably benign Het
Mypn T C 10: 62,955,747 (GRCm39) probably null Het
Ndufb10 T C 17: 24,941,731 (GRCm39) probably null Het
Nelfb G T 2: 25,096,208 (GRCm39) D300E probably benign Het
Nicol1 G A 5: 34,142,270 (GRCm39) R79H probably damaging Het
Odad2 G A 18: 7,223,663 (GRCm39) T460M probably damaging Het
Or2y1d T A 11: 49,321,482 (GRCm39) Y60N probably damaging Het
Or4e5 A T 14: 52,727,988 (GRCm39) C61* probably null Het
Or52n2c T A 7: 104,574,942 (GRCm39) T10S probably benign Het
Or52z15 T A 7: 103,332,574 (GRCm39) D206E probably damaging Het
Pcdha11 C T 18: 37,144,080 (GRCm39) T57M probably benign Het
Pkp1 A T 1: 135,808,593 (GRCm39) I458N possibly damaging Het
Prr12 T A 7: 44,700,653 (GRCm39) probably benign Het
Prrc2c A T 1: 162,532,879 (GRCm39) probably benign Het
Psd4 T C 2: 24,287,259 (GRCm39) F397S probably benign Het
Pygm T C 19: 6,448,169 (GRCm39) I737T probably damaging Het
Rfx1 T A 8: 84,806,743 (GRCm39) probably null Het
Rsl1 A G 13: 67,330,313 (GRCm39) T254A possibly damaging Het
Sh3rf3 A G 10: 58,922,646 (GRCm39) Q574R probably benign Het
Spire1 T C 18: 67,685,849 (GRCm39) probably null Het
St6galnac4 G A 2: 32,484,075 (GRCm39) G91D probably damaging Het
Sytl2 T C 7: 90,031,465 (GRCm39) probably benign Het
Tbpl2 T A 2: 23,983,872 (GRCm39) K188N possibly damaging Het
Tenm3 A T 8: 48,682,172 (GRCm39) M2486K possibly damaging Het
Tpgs1 A T 10: 79,505,325 (GRCm39) N28Y probably benign Het
U2surp A C 9: 95,344,847 (GRCm39) probably benign Het
Vmn2r103 A G 17: 19,993,773 (GRCm39) H50R probably benign Het
Vmn2r19 A G 6: 123,306,869 (GRCm39) N459S probably benign Het
Vmn2r72 T C 7: 85,387,693 (GRCm39) S624G probably damaging Het
Vps13c A G 9: 67,826,603 (GRCm39) T1415A probably benign Het
Vwa5b1 G A 4: 138,336,154 (GRCm39) P147S probably damaging Het
Other mutations in Tgoln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00480:Tgoln1 APN 6 72,593,073 (GRCm39) missense probably benign 0.00
IGL00795:Tgoln1 APN 6 72,593,235 (GRCm39) missense probably benign 0.01
IGL03002:Tgoln1 APN 6 72,593,055 (GRCm39) missense possibly damaging 0.83
IGL03136:Tgoln1 APN 6 72,591,096 (GRCm39) missense probably damaging 1.00
FR4340:Tgoln1 UTSW 6 72,593,334 (GRCm39) small insertion probably benign
R0684:Tgoln1 UTSW 6 72,592,974 (GRCm39) missense probably benign 0.00
R1656:Tgoln1 UTSW 6 72,591,068 (GRCm39) missense probably damaging 0.99
R1920:Tgoln1 UTSW 6 72,593,084 (GRCm39) missense probably benign 0.01
R2057:Tgoln1 UTSW 6 72,592,653 (GRCm39) missense probably benign 0.35
R4097:Tgoln1 UTSW 6 72,592,784 (GRCm39) missense probably damaging 0.98
R4559:Tgoln1 UTSW 6 72,592,664 (GRCm39) missense probably damaging 0.98
R5566:Tgoln1 UTSW 6 72,593,018 (GRCm39) missense possibly damaging 0.92
R6224:Tgoln1 UTSW 6 72,592,984 (GRCm39) missense possibly damaging 0.81
R6814:Tgoln1 UTSW 6 72,592,538 (GRCm39) missense possibly damaging 0.90
R6872:Tgoln1 UTSW 6 72,592,538 (GRCm39) missense possibly damaging 0.90
R7178:Tgoln1 UTSW 6 72,593,028 (GRCm39) missense probably benign 0.01
R7339:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7342:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7347:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7348:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7366:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7368:Tgoln1 UTSW 6 72,593,261 (GRCm39) missense probably benign 0.03
R7491:Tgoln1 UTSW 6 72,593,403 (GRCm39) missense unknown
R8277:Tgoln1 UTSW 6 72,593,838 (GRCm39) start gained probably benign
R8979:Tgoln1 UTSW 6 72,593,262 (GRCm39) missense probably benign 0.00
R9566:Tgoln1 UTSW 6 72,592,911 (GRCm39) missense probably benign 0.00
RF003:Tgoln1 UTSW 6 72,593,335 (GRCm39) nonsense probably null
RF023:Tgoln1 UTSW 6 72,593,063 (GRCm39) small insertion probably benign
RF028:Tgoln1 UTSW 6 72,593,019 (GRCm39) small insertion probably benign
RF030:Tgoln1 UTSW 6 72,593,046 (GRCm39) small insertion probably benign
RF030:Tgoln1 UTSW 6 72,593,019 (GRCm39) small insertion probably benign
RF032:Tgoln1 UTSW 6 72,593,057 (GRCm39) small insertion probably benign
RF032:Tgoln1 UTSW 6 72,593,046 (GRCm39) small insertion probably benign
RF037:Tgoln1 UTSW 6 72,593,019 (GRCm39) small insertion probably benign
RF040:Tgoln1 UTSW 6 72,593,057 (GRCm39) small insertion probably benign
RF042:Tgoln1 UTSW 6 72,593,057 (GRCm39) small insertion probably benign
RF043:Tgoln1 UTSW 6 72,593,046 (GRCm39) small insertion probably benign
RF043:Tgoln1 UTSW 6 72,593,019 (GRCm39) small insertion probably benign
RF057:Tgoln1 UTSW 6 72,593,052 (GRCm39) small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TCGAAGTCTCCGTATCTGGG -3'
(R):5'- GGTAAAGACTACAAGGCCGACC -3'

Sequencing Primer
(F):5'- GGAGGTGGGCTTGTCCAAATC -3'
(R):5'- GACGGTCAGGGGCAGAAGTC -3'
Posted On 2016-05-10