Incidental Mutation 'R4995:Vmn2r72'
ID385172
Institutional Source Beutler Lab
Gene Symbol Vmn2r72
Ensembl Gene ENSMUSG00000051877
Gene Namevomeronasal 2, receptor 72
SynonymsVmn2r72-ps, EG244114
MMRRC Submission 042589-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4995 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85737784-85754981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85738485 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 624 (S624G)
Ref Sequence ENSEMBL: ENSMUSP00000133014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063425]
Predicted Effect probably damaging
Transcript: ENSMUST00000063425
AA Change: S624G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133014
Gene: ENSMUSG00000051877
AA Change: S624G

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 82 469 2.3e-28 PFAM
Pfam:NCD3G 512 564 1.2e-18 PFAM
Pfam:7tm_3 594 832 4e-53 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,494,184 Q333* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acvrl1 G A 15: 101,135,860 R141H probably benign Het
Adprm A G 11: 67,041,610 F158L possibly damaging Het
Aldoart2 C T 12: 55,566,253 T321M probably benign Het
Ap3m2 A G 8: 22,803,776 V86A probably benign Het
Arhgef19 T A 4: 141,247,515 probably null Het
Armc4 G A 18: 7,223,663 T460M probably damaging Het
Bcl2l12 T G 7: 44,994,191 probably null Het
Bptf T C 11: 107,054,565 Q2501R probably damaging Het
C230029F24Rik A T 1: 49,338,136 noncoding transcript Het
C7 C T 15: 5,049,592 G78D probably damaging Het
Caly T C 7: 140,070,625 T135A probably benign Het
Cbl A G 9: 44,153,811 M740T possibly damaging Het
Cbx4 A G 11: 119,081,211 V446A probably benign Het
Celsr1 C A 15: 85,937,911 R1735L probably damaging Het
Cep250 A G 2: 155,988,316 D135G probably damaging Het
Cgn T C 3: 94,779,936 T19A probably damaging Het
Chic2 A T 5: 75,044,204 V32D probably damaging Het
Cntln A G 4: 85,049,883 K780E probably benign Het
Col8a2 A T 4: 126,310,788 D197V probably damaging Het
Crot A T 5: 8,974,000 V372E probably damaging Het
Cyb561d2 C T 9: 107,541,548 V26M probably damaging Het
Ddx5 G A 11: 106,785,236 T237I probably damaging Het
Dmxl2 G T 9: 54,501,441 probably benign Het
Dock8 T A 19: 25,158,383 S1188R probably benign Het
Ehbp1 T A 11: 22,101,073 H493L probably damaging Het
Eif5b T A 1: 38,051,711 *1217K probably null Het
Eprs A G 1: 185,410,139 probably benign Het
Etfdh T C 3: 79,605,788 D376G probably benign Het
Fam186a T C 15: 99,945,099 Q1088R probably benign Het
Fbxw16 G T 9: 109,441,250 T141N probably damaging Het
Fgf11 G A 11: 69,798,759 H138Y probably damaging Het
Gm1673 G A 5: 33,984,926 R79H probably damaging Het
Htra3 T C 5: 35,671,074 E154G probably damaging Het
Hydin T A 8: 110,569,642 V3601D probably damaging Het
Jup G T 11: 100,379,541 S380* probably null Het
Klrg1 T A 6: 122,278,275 D66V probably benign Het
Llgl1 C T 11: 60,709,724 A633V probably benign Het
Lmln T A 16: 33,074,097 Y203* probably null Het
Lrrc58 T G 16: 37,877,056 C165G probably benign Het
Lss T C 10: 76,547,537 V557A probably benign Het
Mast4 T C 13: 102,905,754 probably benign Het
Med13l C A 5: 118,730,949 P754Q possibly damaging Het
Mga C T 2: 119,932,582 R1240* probably null Het
Mgat5b T A 11: 116,974,199 probably null Het
Mtor A G 4: 148,525,752 D1572G probably damaging Het
Muc4 T A 16: 32,754,214 S1363T probably benign Het
Muc4 T A 16: 32,754,041 S1306T probably benign Het
Myo18b A G 5: 112,760,392 V2005A probably damaging Het
Myo1e G A 9: 70,353,272 D571N probably benign Het
Mypn T C 10: 63,119,968 probably null Het
Ndufb10 T C 17: 24,722,757 probably null Het
Nelfb G T 2: 25,206,196 D300E probably benign Het
Olfr1389 T A 11: 49,430,655 Y60N probably damaging Het
Olfr1507 A T 14: 52,490,531 C61* probably null Het
Olfr625-ps1 T A 7: 103,683,367 D206E probably damaging Het
Olfr668 T A 7: 104,925,735 T10S probably benign Het
Pcdha11 C T 18: 37,011,027 T57M probably benign Het
Pkp1 A T 1: 135,880,855 I458N possibly damaging Het
Prr12 T A 7: 45,051,229 probably benign Het
Prrc2c A T 1: 162,705,310 probably benign Het
Psd4 T C 2: 24,397,247 F397S probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rfx1 T A 8: 84,080,114 probably null Het
Rsl1 A G 13: 67,182,249 T254A possibly damaging Het
Sh3rf3 A G 10: 59,086,824 Q574R probably benign Het
Spire1 T C 18: 67,552,779 probably null Het
St6galnac4 G A 2: 32,594,063 G91D probably damaging Het
Sytl2 T C 7: 90,382,257 probably benign Het
Tbpl2 T A 2: 24,093,860 K188N possibly damaging Het
Tenm3 A T 8: 48,229,137 M2486K possibly damaging Het
Tgoln1 A C 6: 72,616,140 V119G possibly damaging Het
Tpgs1 A T 10: 79,669,491 N28Y probably benign Het
U2surp A C 9: 95,462,794 probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Vmn2r19 A G 6: 123,329,910 N459S probably benign Het
Vps13c A G 9: 67,919,321 T1415A probably benign Het
Vwa5b1 G A 4: 138,608,843 P147S probably damaging Het
Other mutations in Vmn2r72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Vmn2r72 APN 7 85749646 missense probably benign 0.01
IGL01019:Vmn2r72 APN 7 85738334 missense probably benign 0.26
IGL01445:Vmn2r72 APN 7 85749646 missense probably benign 0.06
IGL02076:Vmn2r72 APN 7 85738367 missense probably damaging 1.00
IGL02082:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02086:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02089:Vmn2r72 APN 7 85738166 missense probably benign 0.00
IGL02125:Vmn2r72 APN 7 85750711 missense probably benign 0.00
IGL02146:Vmn2r72 APN 7 85737962 missense probably damaging 1.00
IGL02272:Vmn2r72 APN 7 85750693 missense probably benign
IGL02514:Vmn2r72 APN 7 85738699 missense possibly damaging 0.90
IGL02662:Vmn2r72 APN 7 85738183 missense probably benign 0.26
IGL02697:Vmn2r72 APN 7 85738671 missense probably benign 0.36
IGL02733:Vmn2r72 APN 7 85751813 missense probably benign 0.05
IGL03070:Vmn2r72 APN 7 85752041 splice site probably benign
IGL03150:Vmn2r72 APN 7 85751176 missense probably damaging 1.00
IGL03159:Vmn2r72 APN 7 85754954 missense probably benign 0.05
IGL03333:Vmn2r72 APN 7 85750867 missense probably benign 0.10
R0081:Vmn2r72 UTSW 7 85751836 missense probably benign 0.01
R0090:Vmn2r72 UTSW 7 85754876 missense probably benign
R0655:Vmn2r72 UTSW 7 85738111 nonsense probably null
R0778:Vmn2r72 UTSW 7 85749739 missense probably benign 0.00
R1169:Vmn2r72 UTSW 7 85751309 missense probably benign 0.01
R1172:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1173:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1175:Vmn2r72 UTSW 7 85751944 missense probably damaging 1.00
R1248:Vmn2r72 UTSW 7 85749188 missense probably benign 0.02
R1302:Vmn2r72 UTSW 7 85738257 missense probably damaging 1.00
R1506:Vmn2r72 UTSW 7 85749211 missense probably benign
R1632:Vmn2r72 UTSW 7 85751792 missense probably benign 0.13
R1775:Vmn2r72 UTSW 7 85738170 missense probably benign 0.01
R1962:Vmn2r72 UTSW 7 85749161 missense probably benign 0.00
R2201:Vmn2r72 UTSW 7 85738236 missense probably benign 0.12
R2290:Vmn2r72 UTSW 7 85738341 missense probably damaging 1.00
R2327:Vmn2r72 UTSW 7 85738256 missense probably damaging 1.00
R2424:Vmn2r72 UTSW 7 85750953 missense probably damaging 1.00
R2655:Vmn2r72 UTSW 7 85751269 missense possibly damaging 0.95
R2860:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2861:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R2862:Vmn2r72 UTSW 7 85750836 missense probably damaging 0.99
R3009:Vmn2r72 UTSW 7 85749642 missense probably benign 0.00
R3797:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3798:Vmn2r72 UTSW 7 85738077 missense probably benign 0.44
R3902:Vmn2r72 UTSW 7 85749735 missense possibly damaging 0.52
R3959:Vmn2r72 UTSW 7 85751131 missense probably benign 0.36
R3974:Vmn2r72 UTSW 7 85749809 missense probably damaging 1.00
R4399:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4421:Vmn2r72 UTSW 7 85738500 missense probably damaging 1.00
R4426:Vmn2r72 UTSW 7 85737828 nonsense probably null
R4522:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4523:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4533:Vmn2r72 UTSW 7 85751926 missense probably benign 0.44
R4691:Vmn2r72 UTSW 7 85737911 nonsense probably null
R4781:Vmn2r72 UTSW 7 85737861 missense probably benign 0.14
R4863:Vmn2r72 UTSW 7 85750598 missense possibly damaging 0.91
R4952:Vmn2r72 UTSW 7 85751109 missense probably benign
R4991:Vmn2r72 UTSW 7 85751130 missense probably damaging 0.99
R5095:Vmn2r72 UTSW 7 85737853 missense probably damaging 0.98
R5174:Vmn2r72 UTSW 7 85737840 missense probably benign 0.00
R5276:Vmn2r72 UTSW 7 85738254 missense possibly damaging 0.90
R5395:Vmn2r72 UTSW 7 85750897 missense possibly damaging 0.71
R5560:Vmn2r72 UTSW 7 85751942 missense probably damaging 0.96
R5933:Vmn2r72 UTSW 7 85737850 missense probably benign 0.05
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6033:Vmn2r72 UTSW 7 85737929 missense probably damaging 1.00
R6354:Vmn2r72 UTSW 7 85750539 critical splice donor site probably null
R6362:Vmn2r72 UTSW 7 85751174 missense probably damaging 1.00
R6594:Vmn2r72 UTSW 7 85749684 missense probably benign 0.32
R6794:Vmn2r72 UTSW 7 85737996 missense probably damaging 1.00
R7113:Vmn2r72 UTSW 7 85749803 synonymous probably null
R7189:Vmn2r72 UTSW 7 85754917 missense probably benign 0.36
R7266:Vmn2r72 UTSW 7 85738274 nonsense probably null
R7323:Vmn2r72 UTSW 7 85750563 missense probably benign
R7426:Vmn2r72 UTSW 7 85751140 missense probably benign
R7606:Vmn2r72 UTSW 7 85751154 missense possibly damaging 0.91
R7651:Vmn2r72 UTSW 7 85751938 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATACTTGGGTGCCCCTGAC -3'
(R):5'- GCAAATGAAGACCATACTCTCTTC -3'

Sequencing Primer
(F):5'- TTGGGTGCCCCTGACACAAG -3'
(R):5'- ATACTCTCTTCCTCCAAAAAGTTGTG -3'
Posted On2016-05-10