Mutagenetix > Incidental Mutation

Incidental Mutation 'R4995:Cbl'

385182

Institutional Source

Beutler Lab

Gene Symbol

Cbl

Ensembl Gene

ENSMUSG00000034342

Gene Name

Casitas B-lineage lymphoma

Synonyms

Cbl-2, c-Cbl

MMRRC Submission

042589-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.547) question?

Stock #

R4995 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

44142976-44234049 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 44153811 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 740 (M740T)

Ref Sequence

ENSEMBL: ENSMUSP00000146244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037644] [ENSMUST00000205968] [ENSMUST00000206147] [ENSMUST00000206720]

AlphaFold

P22682

Predicted Effect

probably benign
Transcript: ENSMUST00000037644
AA Change: M696T

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000041902
Gene: ENSMUSG00000034342
AA Change: M696T

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	34	46	N/A	INTRINSIC
Pfam:Cbl_N	49	173	9.4e-59	PFAM
Pfam:Cbl_N2	177	260	4.7e-44	PFAM
Pfam:Cbl_N3	262	347	7.2e-48	PFAM
RING	379	417	1.04e-7	SMART
low complexity region	454	463	N/A	INTRINSIC
low complexity region	530	549	N/A	INTRINSIC
UBA	864	901	3.17e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205313

Predicted Effect

probably benign
Transcript: ENSMUST00000205968
AA Change: M723T

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206125

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206147
AA Change: M740T

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

unknown
Transcript: ENSMUST00000206258
AA Change: M39T

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206720
AA Change: M740T

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)

Meta Mutation Damage Score

0.1636

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased thymic CD3 and CD4 expression and tyrosine-phosphorylation, lymphoid hyperplasia, and altered splenic hemopoiesis. Females show increased ductal density and branching in mammary fat pads. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	G	A	2: 19,494,184	Q333*	probably null	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Acvrl1	G	A	15: 101,135,860	R141H	probably benign	Het
Adprm	A	G	11: 67,041,610	F158L	possibly damaging	Het
Aldoart2	C	T	12: 55,566,253	T321M	probably benign	Het
Ap3m2	A	G	8: 22,803,776	V86A	probably benign	Het
Arhgef19	T	A	4: 141,247,515		probably null	Het
Armc4	G	A	18: 7,223,663	T460M	probably damaging	Het
Bcl2l12	T	G	7: 44,994,191		probably null	Het
Bptf	T	C	11: 107,054,565	Q2501R	probably damaging	Het
C230029F24Rik	A	T	1: 49,338,136		noncoding transcript	Het
C7	C	T	15: 5,049,592	G78D	probably damaging	Het
Caly	T	C	7: 140,070,625	T135A	probably benign	Het
Cbx4	A	G	11: 119,081,211	V446A	probably benign	Het
Celsr1	C	A	15: 85,937,911	R1735L	probably damaging	Het
Cep250	A	G	2: 155,988,316	D135G	probably damaging	Het
Cgn	T	C	3: 94,779,936	T19A	probably damaging	Het
Chic2	A	T	5: 75,044,204	V32D	probably damaging	Het
Cntln	A	G	4: 85,049,883	K780E	probably benign	Het
Col8a2	A	T	4: 126,310,788	D197V	probably damaging	Het
Crot	A	T	5: 8,974,000	V372E	probably damaging	Het
Cyb561d2	C	T	9: 107,541,548	V26M	probably damaging	Het
Ddx5	G	A	11: 106,785,236	T237I	probably damaging	Het
Dmxl2	G	T	9: 54,501,441		probably benign	Het
Dock8	T	A	19: 25,158,383	S1188R	probably benign	Het
Ehbp1	T	A	11: 22,101,073	H493L	probably damaging	Het
Eif5b	T	A	1: 38,051,711	*1217K	probably null	Het
Eprs	A	G	1: 185,410,139		probably benign	Het
Etfdh	T	C	3: 79,605,788	D376G	probably benign	Het
Fam186a	T	C	15: 99,945,099	Q1088R	probably benign	Het
Fbxw16	G	T	9: 109,441,250	T141N	probably damaging	Het
Fgf11	G	A	11: 69,798,759	H138Y	probably damaging	Het
Gm1673	G	A	5: 33,984,926	R79H	probably damaging	Het
Htra3	T	C	5: 35,671,074	E154G	probably damaging	Het
Hydin	T	A	8: 110,569,642	V3601D	probably damaging	Het
Jup	G	T	11: 100,379,541	S380*	probably null	Het
Klrg1	T	A	6: 122,278,275	D66V	probably benign	Het
Llgl1	C	T	11: 60,709,724	A633V	probably benign	Het
Lmln	T	A	16: 33,074,097	Y203*	probably null	Het
Lrrc58	T	G	16: 37,877,056	C165G	probably benign	Het
Lss	T	C	10: 76,547,537	V557A	probably benign	Het
Mast4	T	C	13: 102,905,754		probably benign	Het
Med13l	C	A	5: 118,730,949	P754Q	possibly damaging	Het
Mga	C	T	2: 119,932,582	R1240*	probably null	Het
Mgat5b	T	A	11: 116,974,199		probably null	Het
Mtor	A	G	4: 148,525,752	D1572G	probably damaging	Het
Muc4	T	A	16: 32,754,214	S1363T	probably benign	Het
Muc4	T	A	16: 32,754,041	S1306T	probably benign	Het
Myo18b	A	G	5: 112,760,392	V2005A	probably damaging	Het
Myo1e	G	A	9: 70,353,272	D571N	probably benign	Het
Mypn	T	C	10: 63,119,968		probably null	Het
Ndufb10	T	C	17: 24,722,757		probably null	Het
Nelfb	G	T	2: 25,206,196	D300E	probably benign	Het
Olfr1389	T	A	11: 49,430,655	Y60N	probably damaging	Het
Olfr1507	A	T	14: 52,490,531	C61*	probably null	Het
Olfr625-ps1	T	A	7: 103,683,367	D206E	probably damaging	Het
Olfr668	T	A	7: 104,925,735	T10S	probably benign	Het
Pcdha11	C	T	18: 37,011,027	T57M	probably benign	Het
Pkp1	A	T	1: 135,880,855	I458N	possibly damaging	Het
Prr12	T	A	7: 45,051,229		probably benign	Het
Prrc2c	A	T	1: 162,705,310		probably benign	Het
Psd4	T	C	2: 24,397,247	F397S	probably benign	Het
Pygm	T	C	19: 6,398,139	I737T	probably damaging	Het
Rfx1	T	A	8: 84,080,114		probably null	Het
Rsl1	A	G	13: 67,182,249	T254A	possibly damaging	Het
Sh3rf3	A	G	10: 59,086,824	Q574R	probably benign	Het
Spire1	T	C	18: 67,552,779		probably null	Het
St6galnac4	G	A	2: 32,594,063	G91D	probably damaging	Het
Sytl2	T	C	7: 90,382,257		probably benign	Het
Tbpl2	T	A	2: 24,093,860	K188N	possibly damaging	Het
Tenm3	A	T	8: 48,229,137	M2486K	possibly damaging	Het
Tgoln1	A	C	6: 72,616,140	V119G	possibly damaging	Het
Tpgs1	A	T	10: 79,669,491	N28Y	probably benign	Het
U2surp	A	C	9: 95,462,794		probably benign	Het
Vmn2r103	A	G	17: 19,773,511	H50R	probably benign	Het
Vmn2r19	A	G	6: 123,329,910	N459S	probably benign	Het
Vmn2r72	T	C	7: 85,738,485	S624G	probably damaging	Het
Vps13c	A	G	9: 67,919,321	T1415A	probably benign	Het
Vwa5b1	G	A	4: 138,608,843	P147S	probably damaging	Het

Other mutations in Cbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Cbl	APN	9	44201198	missense	probably damaging	1.00
IGL01369:Cbl	APN	9	44201061	nonsense	probably null
IGL01434:Cbl	APN	9	44164206	missense	probably damaging	0.99
IGL01866:Cbl	APN	9	44153825	nonsense	probably null
IGL02326:Cbl	APN	9	44151473	missense	possibly damaging	0.94
IGL02956:Cbl	APN	9	44169034	missense	probably damaging	1.00
Bungalow	UTSW	9	44201119	missense	probably damaging	1.00
Casita	UTSW	9	44164165	missense	probably damaging	1.00
tiny_house	UTSW	9	44164152	missense	probably damaging	1.00
R0068:Cbl	UTSW	9	44154194	missense	probably damaging	0.98
R0390:Cbl	UTSW	9	44201005	missense	probably damaging	1.00
R0655:Cbl	UTSW	9	44158752	missense	probably damaging	1.00
R0764:Cbl	UTSW	9	44164152	missense	probably damaging	1.00
R1466:Cbl	UTSW	9	44154244	missense	probably benign	0.10
R1466:Cbl	UTSW	9	44154244	missense	probably benign	0.10
R1616:Cbl	UTSW	9	44152900	missense	probably damaging	0.99
R1736:Cbl	UTSW	9	44152895	missense	possibly damaging	0.80
R1808:Cbl	UTSW	9	44164229	missense	probably damaging	1.00
R1865:Cbl	UTSW	9	44164165	missense	probably damaging	1.00
R3156:Cbl	UTSW	9	44158850	missense	possibly damaging	0.74
R3431:Cbl	UTSW	9	44151446	makesense	probably null
R4668:Cbl	UTSW	9	44153848	missense	probably benign	0.00
R4700:Cbl	UTSW	9	44173380	missense	probably damaging	1.00
R4866:Cbl	UTSW	9	44152869	missense	probably benign	0.00
R4900:Cbl	UTSW	9	44152869	missense	probably benign	0.00
R5014:Cbl	UTSW	9	44154399	splice site	probably null
R5324:Cbl	UTSW	9	44154254	missense	probably damaging	0.97
R5353:Cbl	UTSW	9	44173323	missense	probably damaging	1.00
R5382:Cbl	UTSW	9	44159021	missense	probably benign
R5747:Cbl	UTSW	9	44201119	missense	probably damaging	1.00
R5834:Cbl	UTSW	9	44233779	missense	probably damaging	1.00
R6307:Cbl	UTSW	9	44158512	critical splice donor site	probably null
R6755:Cbl	UTSW	9	44173374	missense	probably damaging	0.98
R7393:Cbl	UTSW	9	44154188	critical splice donor site	probably null
R7779:Cbl	UTSW	9	44159096	missense	probably benign
R7789:Cbl	UTSW	9	44163467	missense	probably damaging	1.00
R8094:Cbl	UTSW	9	44163399	missense	probably benign	0.03
R8104:Cbl	UTSW	9	44158539	missense	possibly damaging	0.93
R8146:Cbl	UTSW	9	44164874	missense	probably damaging	1.00
R8340:Cbl	UTSW	9	44159000	missense	possibly damaging	0.77
R8424:Cbl	UTSW	9	44152854	missense	possibly damaging	0.51
R8920:Cbl	UTSW	9	44167273	missense	probably damaging	0.99
R9185:Cbl	UTSW	9	44152840	missense	probably damaging	1.00
X0057:Cbl	UTSW	9	44233767	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- AAGTGGGTCCATCTTGTCCAC -3'
(R):5'- GGCCTCTAGAACATGCACATC -3'

Sequencing Primer
(F):5'- CCAGACAGGGTATTTGCTATGCAG -3'
(R):5'- GCACATCTGATCTTGTCATGAGTCAG -3'

Posted On

2016-05-10