Mutagenetix > Incidental Mutation

Incidental Mutation 'R4995:Dmxl2'

385183

Institutional Source

Beutler Lab

Gene Symbol

Dmxl2

Ensembl Gene

ENSMUSG00000041268

Gene Name

Dmx-like 2

Synonyms

E130119P06Rik, 6430411K14Rik

MMRRC Submission

042589-MU

Accession Numbers

NCBI RefSeq: NM_172771.2; MGI:2444630

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4995 (G1)

Quality Score

188

Status

Validated

Chromosome

Chromosomal Location

54365158-54501626 bp(-) (GRCm38)

Type of Mutation

utr 5 prime

DNA Base Change (assembly)

G to T at 54501441 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113693 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000118163] [ENSMUST00000118600]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000118163

SMART Domains

Protein: ENSMUSP00000113705
Gene: ENSMUSG00000041268

Domain	Start	End	E-Value	Type
WD40	43	84	4.58e1	SMART
WD40	100	136	2.28e2	SMART
WD40	159	198	2.57e-2	SMART
WD40	221	269	1.03e-1	SMART
low complexity region	420	440	N/A	INTRINSIC
WD40	741	793	1.42e2	SMART
low complexity region	861	875	N/A	INTRINSIC
low complexity region	945	961	N/A	INTRINSIC
WD40	985	1029	1.15e1	SMART
WD40	1236	1273	2.84e2	SMART
Pfam:Rav1p_C	1430	1903	1.5e-71	PFAM
low complexity region	1978	1993	N/A	INTRINSIC
coiled coil region	2118	2146	N/A	INTRINSIC
low complexity region	2189	2204	N/A	INTRINSIC
low complexity region	2251	2266	N/A	INTRINSIC
low complexity region	2472	2490	N/A	INTRINSIC
low complexity region	2635	2649	N/A	INTRINSIC
low complexity region	2744	2766	N/A	INTRINSIC
WD40	2774	2809	5.73e0	SMART
WD40	2813	2852	8.88e0	SMART
WD40	2859	2901	2.67e-1	SMART
WD40	2907	2946	2.57e-2	SMART
WD40	2949	2988	3.61e-6	SMART
WD40	3001	3039	8.25e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118600

SMART Domains

Protein: ENSMUSP00000113693
Gene: ENSMUSG00000041268

Domain	Start	End	E-Value	Type
WD40	43	84	4.58e1	SMART
WD40	100	136	2.28e2	SMART
WD40	159	198	2.57e-2	SMART
WD40	221	269	1.03e-1	SMART
low complexity region	420	440	N/A	INTRINSIC
WD40	741	793	1.42e2	SMART
low complexity region	861	875	N/A	INTRINSIC
low complexity region	945	961	N/A	INTRINSIC
WD40	985	1029	1.15e1	SMART
WD40	1236	1273	2.84e2	SMART
low complexity region	1426	1436	N/A	INTRINSIC
Pfam:Rav1p_C	1447	1903	4.2e-68	PFAM
low complexity region	1978	1993	N/A	INTRINSIC
coiled coil region	2118	2146	N/A	INTRINSIC
low complexity region	2189	2204	N/A	INTRINSIC
low complexity region	2251	2266	N/A	INTRINSIC
low complexity region	2471	2489	N/A	INTRINSIC
low complexity region	2722	2744	N/A	INTRINSIC
WD40	2752	2787	5.73e0	SMART
WD40	2791	2830	8.88e0	SMART
WD40	2837	2879	2.67e-1	SMART
WD40	2885	2924	2.57e-2	SMART
WD40	2927	2966	3.61e-6	SMART
WD40	2979	3017	8.25e0	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144736

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149709

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with 12 WD domains. Proteins with WD domains are involved in many functions including participation in signal transduction pathways. Participation of the encoded protein in regulation of the Notch signaling pathway has been demonstrated in vitro using several human cell lines (PMID:20810660). A gene encoding a similar protein is located on chromosome 5. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete prenatal lethality. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(2)

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	G	A	2: 19,494,184	Q333*	probably null	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Acvrl1	G	A	15: 101,135,860	R141H	probably benign	Het
Adprm	A	G	11: 67,041,610	F158L	possibly damaging	Het
Aldoart2	C	T	12: 55,566,253	T321M	probably benign	Het
Ap3m2	A	G	8: 22,803,776	V86A	probably benign	Het
Arhgef19	T	A	4: 141,247,515		probably null	Het
Armc4	G	A	18: 7,223,663	T460M	probably damaging	Het
Bcl2l12	T	G	7: 44,994,191		probably null	Het
Bptf	T	C	11: 107,054,565	Q2501R	probably damaging	Het
C230029F24Rik	A	T	1: 49,338,136		noncoding transcript	Het
C7	C	T	15: 5,049,592	G78D	probably damaging	Het
Caly	T	C	7: 140,070,625	T135A	probably benign	Het
Cbl	A	G	9: 44,153,811	M740T	possibly damaging	Het
Cbx4	A	G	11: 119,081,211	V446A	probably benign	Het
Celsr1	C	A	15: 85,937,911	R1735L	probably damaging	Het
Cep250	A	G	2: 155,988,316	D135G	probably damaging	Het
Cgn	T	C	3: 94,779,936	T19A	probably damaging	Het
Chic2	A	T	5: 75,044,204	V32D	probably damaging	Het
Cntln	A	G	4: 85,049,883	K780E	probably benign	Het
Col8a2	A	T	4: 126,310,788	D197V	probably damaging	Het
Crot	A	T	5: 8,974,000	V372E	probably damaging	Het
Cyb561d2	C	T	9: 107,541,548	V26M	probably damaging	Het
Ddx5	G	A	11: 106,785,236	T237I	probably damaging	Het
Dock8	T	A	19: 25,158,383	S1188R	probably benign	Het
Ehbp1	T	A	11: 22,101,073	H493L	probably damaging	Het
Eif5b	T	A	1: 38,051,711	*1217K	probably null	Het
Eprs	A	G	1: 185,410,139		probably benign	Het
Etfdh	T	C	3: 79,605,788	D376G	probably benign	Het
Fam186a	T	C	15: 99,945,099	Q1088R	probably benign	Het
Fbxw16	G	T	9: 109,441,250	T141N	probably damaging	Het
Fgf11	G	A	11: 69,798,759	H138Y	probably damaging	Het
Gm1673	G	A	5: 33,984,926	R79H	probably damaging	Het
Htra3	T	C	5: 35,671,074	E154G	probably damaging	Het
Hydin	T	A	8: 110,569,642	V3601D	probably damaging	Het
Jup	G	T	11: 100,379,541	S380*	probably null	Het
Klrg1	T	A	6: 122,278,275	D66V	probably benign	Het
Llgl1	C	T	11: 60,709,724	A633V	probably benign	Het
Lmln	T	A	16: 33,074,097	Y203*	probably null	Het
Lrrc58	T	G	16: 37,877,056	C165G	probably benign	Het
Lss	T	C	10: 76,547,537	V557A	probably benign	Het
Mast4	T	C	13: 102,905,754		probably benign	Het
Med13l	C	A	5: 118,730,949	P754Q	possibly damaging	Het
Mga	C	T	2: 119,932,582	R1240*	probably null	Het
Mgat5b	T	A	11: 116,974,199		probably null	Het
Mtor	A	G	4: 148,525,752	D1572G	probably damaging	Het
Muc4	T	A	16: 32,754,214	S1363T	probably benign	Het
Muc4	T	A	16: 32,754,041	S1306T	probably benign	Het
Myo18b	A	G	5: 112,760,392	V2005A	probably damaging	Het
Myo1e	G	A	9: 70,353,272	D571N	probably benign	Het
Mypn	T	C	10: 63,119,968		probably null	Het
Ndufb10	T	C	17: 24,722,757		probably null	Het
Nelfb	G	T	2: 25,206,196	D300E	probably benign	Het
Olfr1389	T	A	11: 49,430,655	Y60N	probably damaging	Het
Olfr1507	A	T	14: 52,490,531	C61*	probably null	Het
Olfr625-ps1	T	A	7: 103,683,367	D206E	probably damaging	Het
Olfr668	T	A	7: 104,925,735	T10S	probably benign	Het
Pcdha11	C	T	18: 37,011,027	T57M	probably benign	Het
Pkp1	A	T	1: 135,880,855	I458N	possibly damaging	Het
Prr12	T	A	7: 45,051,229		probably benign	Het
Prrc2c	A	T	1: 162,705,310		probably benign	Het
Psd4	T	C	2: 24,397,247	F397S	probably benign	Het
Pygm	T	C	19: 6,398,139	I737T	probably damaging	Het
Rfx1	T	A	8: 84,080,114		probably null	Het
Rsl1	A	G	13: 67,182,249	T254A	possibly damaging	Het
Sh3rf3	A	G	10: 59,086,824	Q574R	probably benign	Het
Spire1	T	C	18: 67,552,779		probably null	Het
St6galnac4	G	A	2: 32,594,063	G91D	probably damaging	Het
Sytl2	T	C	7: 90,382,257		probably benign	Het
Tbpl2	T	A	2: 24,093,860	K188N	possibly damaging	Het
Tenm3	A	T	8: 48,229,137	M2486K	possibly damaging	Het
Tgoln1	A	C	6: 72,616,140	V119G	possibly damaging	Het
Tpgs1	A	T	10: 79,669,491	N28Y	probably benign	Het
U2surp	A	C	9: 95,462,794		probably benign	Het
Vmn2r103	A	G	17: 19,773,511	H50R	probably benign	Het
Vmn2r19	A	G	6: 123,329,910	N459S	probably benign	Het
Vmn2r72	T	C	7: 85,738,485	S624G	probably damaging	Het
Vps13c	A	G	9: 67,919,321	T1415A	probably benign	Het
Vwa5b1	G	A	4: 138,608,843	P147S	probably damaging	Het

Other mutations in Dmxl2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Dmxl2	APN	9	54401704	missense	probably benign
IGL00226:Dmxl2	APN	9	54415993	missense	probably damaging	1.00
IGL00419:Dmxl2	APN	9	54406667	missense	probably damaging	0.96
IGL00551:Dmxl2	APN	9	54450838	missense	probably damaging	1.00
IGL00765:Dmxl2	APN	9	54415422	unclassified	probably benign
IGL00852:Dmxl2	APN	9	54423313	nonsense	probably null
IGL00857:Dmxl2	APN	9	54376320	missense	probably benign	0.32
IGL00952:Dmxl2	APN	9	54416882	missense	probably damaging	0.99
IGL01139:Dmxl2	APN	9	54458964	missense	probably damaging	1.00
IGL01346:Dmxl2	APN	9	54415475	missense	probably damaging	1.00
IGL01538:Dmxl2	APN	9	54445376	splice site	probably benign
IGL01645:Dmxl2	APN	9	54378733	missense	possibly damaging	0.93
IGL02096:Dmxl2	APN	9	54401065	missense	possibly damaging	0.89
IGL02104:Dmxl2	APN	9	54404015	nonsense	probably null
IGL02145:Dmxl2	APN	9	54374697	missense	probably benign	0.29
IGL02210:Dmxl2	APN	9	54404049	missense	probably damaging	1.00
IGL02238:Dmxl2	APN	9	54445433	missense	probably damaging	1.00
IGL02255:Dmxl2	APN	9	54393768	missense	probably benign	0.06
IGL02364:Dmxl2	APN	9	54393843	missense	probably benign	0.02
IGL02423:Dmxl2	APN	9	54393748	missense	possibly damaging	0.89
IGL02440:Dmxl2	APN	9	54406615	missense	probably damaging	0.98
IGL02546:Dmxl2	APN	9	54366414	utr 3 prime	probably benign
IGL02668:Dmxl2	APN	9	54416945	missense	probably damaging	1.00
IGL03229:Dmxl2	APN	9	54404172	missense	probably damaging	1.00
IGL03244:Dmxl2	APN	9	54416371	missense	probably damaging	1.00
IGL03277:Dmxl2	APN	9	54404220	missense	probably damaging	1.00
IGL03399:Dmxl2	APN	9	54446672	missense	probably damaging	1.00
BB003:Dmxl2	UTSW	9	54428042	missense	probably benign	0.01
BB013:Dmxl2	UTSW	9	54428042	missense	probably benign	0.01
I2288:Dmxl2	UTSW	9	54401793	missense	probably damaging	1.00
P0014:Dmxl2	UTSW	9	54401764	missense	probably damaging	1.00
R0411:Dmxl2	UTSW	9	54378939	missense	probably damaging	1.00
R0422:Dmxl2	UTSW	9	54399940	critical splice donor site	probably null
R0432:Dmxl2	UTSW	9	54416951	missense	probably benign	0.01
R0436:Dmxl2	UTSW	9	54383750	missense	probably damaging	1.00
R0538:Dmxl2	UTSW	9	54393836	missense	probably benign	0.06
R0603:Dmxl2	UTSW	9	54405906	missense	possibly damaging	0.95
R0605:Dmxl2	UTSW	9	54419945	missense	probably benign	0.01
R0625:Dmxl2	UTSW	9	54382702	missense	probably benign
R0626:Dmxl2	UTSW	9	54416554	missense	probably damaging	1.00
R0736:Dmxl2	UTSW	9	54378817	missense	probably damaging	0.99
R0847:Dmxl2	UTSW	9	54405828	missense	probably damaging	1.00
R0855:Dmxl2	UTSW	9	54366440	missense	probably benign	0.03
R0962:Dmxl2	UTSW	9	54446412	missense	probably damaging	0.99
R1015:Dmxl2	UTSW	9	54367765	missense	probably benign	0.32
R1084:Dmxl2	UTSW	9	54416433	missense	probably damaging	1.00
R1328:Dmxl2	UTSW	9	54396249	missense	probably benign	0.12
R1401:Dmxl2	UTSW	9	54415428	critical splice donor site	probably null
R1503:Dmxl2	UTSW	9	54446988	nonsense	probably null
R1609:Dmxl2	UTSW	9	54409263	missense	possibly damaging	0.90
R1613:Dmxl2	UTSW	9	54382027	missense	probably benign
R1660:Dmxl2	UTSW	9	54451030	missense	possibly damaging	0.68
R1712:Dmxl2	UTSW	9	54401485	missense	probably benign	0.00
R1772:Dmxl2	UTSW	9	54423224	splice site	probably benign
R1832:Dmxl2	UTSW	9	54460949	missense	probably damaging	0.97
R1922:Dmxl2	UTSW	9	54401523	missense	probably benign
R2104:Dmxl2	UTSW	9	54415564	missense	probably damaging	1.00
R2109:Dmxl2	UTSW	9	54393813	missense	probably benign	0.06
R2145:Dmxl2	UTSW	9	54415910	missense	probably damaging	1.00
R2199:Dmxl2	UTSW	9	54376243	missense	probably benign	0.35
R2352:Dmxl2	UTSW	9	54393862	missense	probably damaging	1.00
R2516:Dmxl2	UTSW	9	54400094	missense	probably damaging	1.00
R2981:Dmxl2	UTSW	9	54393702	missense	probably damaging	1.00
R3430:Dmxl2	UTSW	9	54477461	missense	possibly damaging	0.94
R3625:Dmxl2	UTSW	9	54393643	missense	probably benign	0.23
R3725:Dmxl2	UTSW	9	54393769	missense	probably damaging	1.00
R3787:Dmxl2	UTSW	9	54369878	missense	probably damaging	1.00
R4002:Dmxl2	UTSW	9	54473832	splice site	probably benign
R4004:Dmxl2	UTSW	9	54446390	missense	probably benign	0.04
R4005:Dmxl2	UTSW	9	54446390	missense	probably benign	0.04
R4012:Dmxl2	UTSW	9	54379013	splice site	probably null
R4014:Dmxl2	UTSW	9	54378709	splice site	probably null
R4115:Dmxl2	UTSW	9	54446988	nonsense	probably null
R4232:Dmxl2	UTSW	9	54419909	missense	possibly damaging	0.89
R4388:Dmxl2	UTSW	9	54396267	missense	probably damaging	1.00
R4513:Dmxl2	UTSW	9	54419884	missense	probably null	0.17
R4552:Dmxl2	UTSW	9	54451763	missense	probably damaging	1.00
R4609:Dmxl2	UTSW	9	54446512	missense	probably damaging	1.00
R4625:Dmxl2	UTSW	9	54404120	missense	possibly damaging	0.55
R4694:Dmxl2	UTSW	9	54446905	missense	probably benign	0.04
R4711:Dmxl2	UTSW	9	54450924	missense	probably benign	0.37
R4715:Dmxl2	UTSW	9	54446405	splice site	probably null
R4746:Dmxl2	UTSW	9	54451796	missense	probably benign	0.04
R4789:Dmxl2	UTSW	9	54379815	missense	probably benign	0.30
R4825:Dmxl2	UTSW	9	54404041	missense	probably benign	0.01
R4911:Dmxl2	UTSW	9	54411653	missense	probably damaging	1.00
R5026:Dmxl2	UTSW	9	54416676	missense	probably damaging	1.00
R5118:Dmxl2	UTSW	9	54460987	missense	probably damaging	1.00
R5174:Dmxl2	UTSW	9	54445484	splice site	probably null
R5288:Dmxl2	UTSW	9	54378757	missense	probably benign
R5373:Dmxl2	UTSW	9	54369189	intron	probably benign
R5374:Dmxl2	UTSW	9	54369189	intron	probably benign
R5385:Dmxl2	UTSW	9	54378757	missense	probably benign
R5386:Dmxl2	UTSW	9	54378757	missense	probably benign
R5418:Dmxl2	UTSW	9	54374651	critical splice donor site	probably null
R5540:Dmxl2	UTSW	9	54393857	missense	probably benign	0.21
R5568:Dmxl2	UTSW	9	54423359	splice site	probably null
R5733:Dmxl2	UTSW	9	54376266	missense	possibly damaging	0.64
R5758:Dmxl2	UTSW	9	54472964	missense	probably benign	0.28
R5759:Dmxl2	UTSW	9	54375508	missense	probably damaging	1.00
R5893:Dmxl2	UTSW	9	54387420	missense	possibly damaging	0.64
R6030:Dmxl2	UTSW	9	54393673	missense	probably benign	0.18
R6030:Dmxl2	UTSW	9	54393673	missense	probably benign	0.18
R6041:Dmxl2	UTSW	9	54416753	missense	probably damaging	1.00
R6174:Dmxl2	UTSW	9	54393727	missense	probably damaging	1.00
R6278:Dmxl2	UTSW	9	54415762	missense	probably damaging	1.00
R6307:Dmxl2	UTSW	9	54382706	missense	possibly damaging	0.68
R6349:Dmxl2	UTSW	9	54419909	missense	possibly damaging	0.89
R6404:Dmxl2	UTSW	9	54375536	missense	probably damaging	1.00
R6516:Dmxl2	UTSW	9	54416676	missense	probably damaging	1.00
R6712:Dmxl2	UTSW	9	54411624	missense	probably damaging	1.00
R6747:Dmxl2	UTSW	9	54416088	missense	probably damaging	1.00
R6769:Dmxl2	UTSW	9	54416524	missense	probably damaging	1.00
R6771:Dmxl2	UTSW	9	54416524	missense	probably damaging	1.00
R6800:Dmxl2	UTSW	9	54409183	missense	probably damaging	1.00
R6891:Dmxl2	UTSW	9	54480380	missense	probably damaging	0.99
R6920:Dmxl2	UTSW	9	54472212	missense	probably damaging	1.00
R6979:Dmxl2	UTSW	9	54450879	missense	possibly damaging	0.49
R7147:Dmxl2	UTSW	9	54416729	missense	probably benign	0.06
R7327:Dmxl2	UTSW	9	54401585	missense	probably damaging	1.00
R7462:Dmxl2	UTSW	9	54366632	splice site	probably null
R7526:Dmxl2	UTSW	9	54400957	missense	possibly damaging	0.47
R7569:Dmxl2	UTSW	9	54415987	missense	possibly damaging	0.51
R7622:Dmxl2	UTSW	9	54472218	missense	probably damaging	0.99
R7638:Dmxl2	UTSW	9	54457794	missense	unknown
R7703:Dmxl2	UTSW	9	54461086	missense	probably benign	0.01
R7768:Dmxl2	UTSW	9	54380939	missense	probably damaging	1.00
R7926:Dmxl2	UTSW	9	54428042	missense	probably benign	0.01
R7969:Dmxl2	UTSW	9	54446881	missense	possibly damaging	0.85
R8007:Dmxl2	UTSW	9	54383691	nonsense	probably null
R8200:Dmxl2	UTSW	9	54480346	missense	probably benign
R8311:Dmxl2	UTSW	9	54446933	missense	probably benign	0.00
R8320:Dmxl2	UTSW	9	54383759	missense	probably benign
R8377:Dmxl2	UTSW	9	54378748	missense	probably damaging	1.00
R8400:Dmxl2	UTSW	9	54383753	missense	probably benign	0.03
R8509:Dmxl2	UTSW	9	54428057	nonsense	probably null
R8698:Dmxl2	UTSW	9	54374669	missense	probably benign	0.10
R8768:Dmxl2	UTSW	9	54393821	missense	possibly damaging	0.83
R8770:Dmxl2	UTSW	9	54404014	missense	probably benign	0.01
R8799:Dmxl2	UTSW	9	54419743	critical splice donor site	probably null
R8840:Dmxl2	UTSW	9	54401855	missense	possibly damaging	0.58
R8898:Dmxl2	UTSW	9	54401657	missense	probably benign	0.01
R8954:Dmxl2	UTSW	9	54473872	missense	probably benign	0.04
R9083:Dmxl2	UTSW	9	54409264	missense	probably benign	0.29
R9114:Dmxl2	UTSW	9	54400037	missense
R9115:Dmxl2	UTSW	9	54401727	missense	probably benign
R9263:Dmxl2	UTSW	9	54451661	missense	probably benign	0.01
R9272:Dmxl2	UTSW	9	54404120	missense	possibly damaging	0.55
R9577:Dmxl2	UTSW	9	54416380	missense	unknown
R9673:Dmxl2	UTSW	9	54387556	missense	probably damaging	1.00
R9722:Dmxl2	UTSW	9	54416608	missense	probably benign	0.00
R9726:Dmxl2	UTSW	9	54415712	missense	probably benign	0.09
R9797:Dmxl2	UTSW	9	54450903	missense	probably benign	0.00
X0064:Dmxl2	UTSW	9	54401713	missense	probably benign
Z1177:Dmxl2	UTSW	9	54382034	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- AGGGCGGTGATTCCTCATC -3'
(R):5'- TTAGCAAAACAGGCCGGCC -3'

Sequencing Primer
(F):5'- GCGGTGATTCCTCATCCTTCC -3'
(R):5'- AGCATCCGGGCATTTCC -3'

Posted On

2016-05-10