Incidental Mutation 'R4995:Myo1e'
ID385185
Institutional Source Beutler Lab
Gene Symbol Myo1e
Ensembl Gene ENSMUSG00000032220
Gene Namemyosin IE
Synonyms2310020N23Rik, 9130023P14Rik
MMRRC Submission 042589-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4995 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location70207350-70399766 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 70353272 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 571 (D571N)
Ref Sequence ENSEMBL: ENSMUSP00000034745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]
PDB Structure
MYOSIN 1E SH3 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034745
AA Change: D571N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: D571N

DomainStartEndE-ValueType
MYSc 13 693 N/A SMART
Pfam:Myosin_TH1 719 917 1e-55 PFAM
SH3 1053 1107 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000214042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214767
Meta Mutation Damage Score 0.1277 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,494,184 Q333* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acvrl1 G A 15: 101,135,860 R141H probably benign Het
Adprm A G 11: 67,041,610 F158L possibly damaging Het
Aldoart2 C T 12: 55,566,253 T321M probably benign Het
Ap3m2 A G 8: 22,803,776 V86A probably benign Het
Arhgef19 T A 4: 141,247,515 probably null Het
Armc4 G A 18: 7,223,663 T460M probably damaging Het
Bcl2l12 T G 7: 44,994,191 probably null Het
Bptf T C 11: 107,054,565 Q2501R probably damaging Het
C230029F24Rik A T 1: 49,338,136 noncoding transcript Het
C7 C T 15: 5,049,592 G78D probably damaging Het
Caly T C 7: 140,070,625 T135A probably benign Het
Cbl A G 9: 44,153,811 M740T possibly damaging Het
Cbx4 A G 11: 119,081,211 V446A probably benign Het
Celsr1 C A 15: 85,937,911 R1735L probably damaging Het
Cep250 A G 2: 155,988,316 D135G probably damaging Het
Cgn T C 3: 94,779,936 T19A probably damaging Het
Chic2 A T 5: 75,044,204 V32D probably damaging Het
Cntln A G 4: 85,049,883 K780E probably benign Het
Col8a2 A T 4: 126,310,788 D197V probably damaging Het
Crot A T 5: 8,974,000 V372E probably damaging Het
Cyb561d2 C T 9: 107,541,548 V26M probably damaging Het
Ddx5 G A 11: 106,785,236 T237I probably damaging Het
Dmxl2 G T 9: 54,501,441 probably benign Het
Dock8 T A 19: 25,158,383 S1188R probably benign Het
Ehbp1 T A 11: 22,101,073 H493L probably damaging Het
Eif5b T A 1: 38,051,711 *1217K probably null Het
Eprs A G 1: 185,410,139 probably benign Het
Etfdh T C 3: 79,605,788 D376G probably benign Het
Fam186a T C 15: 99,945,099 Q1088R probably benign Het
Fbxw16 G T 9: 109,441,250 T141N probably damaging Het
Fgf11 G A 11: 69,798,759 H138Y probably damaging Het
Gm1673 G A 5: 33,984,926 R79H probably damaging Het
Htra3 T C 5: 35,671,074 E154G probably damaging Het
Hydin T A 8: 110,569,642 V3601D probably damaging Het
Jup G T 11: 100,379,541 S380* probably null Het
Klrg1 T A 6: 122,278,275 D66V probably benign Het
Llgl1 C T 11: 60,709,724 A633V probably benign Het
Lmln T A 16: 33,074,097 Y203* probably null Het
Lrrc58 T G 16: 37,877,056 C165G probably benign Het
Lss T C 10: 76,547,537 V557A probably benign Het
Mast4 T C 13: 102,905,754 probably benign Het
Med13l C A 5: 118,730,949 P754Q possibly damaging Het
Mga C T 2: 119,932,582 R1240* probably null Het
Mgat5b T A 11: 116,974,199 probably null Het
Mtor A G 4: 148,525,752 D1572G probably damaging Het
Muc4 T A 16: 32,754,214 S1363T probably benign Het
Muc4 T A 16: 32,754,041 S1306T probably benign Het
Myo18b A G 5: 112,760,392 V2005A probably damaging Het
Mypn T C 10: 63,119,968 probably null Het
Ndufb10 T C 17: 24,722,757 probably null Het
Nelfb G T 2: 25,206,196 D300E probably benign Het
Olfr1389 T A 11: 49,430,655 Y60N probably damaging Het
Olfr1507 A T 14: 52,490,531 C61* probably null Het
Olfr625-ps1 T A 7: 103,683,367 D206E probably damaging Het
Olfr668 T A 7: 104,925,735 T10S probably benign Het
Pcdha11 C T 18: 37,011,027 T57M probably benign Het
Pkp1 A T 1: 135,880,855 I458N possibly damaging Het
Prr12 T A 7: 45,051,229 probably benign Het
Prrc2c A T 1: 162,705,310 probably benign Het
Psd4 T C 2: 24,397,247 F397S probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rfx1 T A 8: 84,080,114 probably null Het
Rsl1 A G 13: 67,182,249 T254A possibly damaging Het
Sh3rf3 A G 10: 59,086,824 Q574R probably benign Het
Spire1 T C 18: 67,552,779 probably null Het
St6galnac4 G A 2: 32,594,063 G91D probably damaging Het
Sytl2 T C 7: 90,382,257 probably benign Het
Tbpl2 T A 2: 24,093,860 K188N possibly damaging Het
Tenm3 A T 8: 48,229,137 M2486K possibly damaging Het
Tgoln1 A C 6: 72,616,140 V119G possibly damaging Het
Tpgs1 A T 10: 79,669,491 N28Y probably benign Het
U2surp A C 9: 95,462,794 probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Vmn2r19 A G 6: 123,329,910 N459S probably benign Het
Vmn2r72 T C 7: 85,738,485 S624G probably damaging Het
Vps13c A G 9: 67,919,321 T1415A probably benign Het
Vwa5b1 G A 4: 138,608,843 P147S probably damaging Het
Other mutations in Myo1e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Myo1e APN 9 70342148 missense probably benign 0.01
IGL00833:Myo1e APN 9 70338778 missense probably damaging 0.99
IGL00973:Myo1e APN 9 70338787 missense probably damaging 1.00
IGL01011:Myo1e APN 9 70316589 splice site probably benign
IGL01401:Myo1e APN 9 70327166 missense probably damaging 0.97
IGL01402:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01404:Myo1e APN 9 70337766 missense probably benign 0.02
IGL01613:Myo1e APN 9 70341273 splice site probably benign
IGL01738:Myo1e APN 9 70359370 missense probably damaging 1.00
IGL01819:Myo1e APN 9 70343040 splice site probably benign
IGL02233:Myo1e APN 9 70383799 splice site probably benign
IGL02244:Myo1e APN 9 70367689 missense probably benign 0.00
IGL02440:Myo1e APN 9 70346740 missense probably damaging 1.00
IGL02806:Myo1e APN 9 70362270 missense probably benign 0.01
IGL02886:Myo1e APN 9 70368773 missense probably benign 0.00
IGL03178:Myo1e APN 9 70286949 missense possibly damaging 0.47
I2288:Myo1e UTSW 9 70342097 missense possibly damaging 0.80
R0036:Myo1e UTSW 9 70341308 missense probably damaging 1.00
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0238:Myo1e UTSW 9 70342126 missense possibly damaging 0.86
R0399:Myo1e UTSW 9 70301793 splice site probably benign
R0526:Myo1e UTSW 9 70322398 missense probably damaging 1.00
R0599:Myo1e UTSW 9 70376660 splice site probably benign
R0656:Myo1e UTSW 9 70367674 missense probably damaging 1.00
R1078:Myo1e UTSW 9 70383999 missense probably benign
R1278:Myo1e UTSW 9 70398785 missense probably damaging 1.00
R1300:Myo1e UTSW 9 70301783 missense probably damaging 1.00
R1329:Myo1e UTSW 9 70338738 missense possibly damaging 0.96
R1349:Myo1e UTSW 9 70287069 splice site probably benign
R1463:Myo1e UTSW 9 70338756 missense possibly damaging 0.88
R1656:Myo1e UTSW 9 70395934 missense probably damaging 1.00
R1727:Myo1e UTSW 9 70376524 missense possibly damaging 0.88
R1789:Myo1e UTSW 9 70338784 missense probably damaging 1.00
R1970:Myo1e UTSW 9 70368773 missense probably benign 0.00
R2029:Myo1e UTSW 9 70368687 missense possibly damaging 0.78
R2029:Myo1e UTSW 9 70378715 splice site probably benign
R2039:Myo1e UTSW 9 70320133 missense possibly damaging 0.89
R2076:Myo1e UTSW 9 70383877 missense probably benign
R2256:Myo1e UTSW 9 70378373 splice site probably null
R2257:Myo1e UTSW 9 70378373 splice site probably null
R2323:Myo1e UTSW 9 70378758 nonsense probably null
R2443:Myo1e UTSW 9 70327172 missense probably benign
R4023:Myo1e UTSW 9 70324875 missense probably benign
R4024:Myo1e UTSW 9 70324875 missense probably benign
R4025:Myo1e UTSW 9 70324875 missense probably benign
R4026:Myo1e UTSW 9 70324875 missense probably benign
R4151:Myo1e UTSW 9 70297351 nonsense probably null
R4764:Myo1e UTSW 9 70343135 splice site probably null
R4768:Myo1e UTSW 9 70370469 missense possibly damaging 0.63
R4911:Myo1e UTSW 9 70343096 missense probably benign
R4999:Myo1e UTSW 9 70353312 missense probably damaging 1.00
R5228:Myo1e UTSW 9 70322358 intron probably null
R5414:Myo1e UTSW 9 70322358 intron probably null
R5577:Myo1e UTSW 9 70370471 missense probably benign 0.31
R5851:Myo1e UTSW 9 70383804 missense probably benign 0.17
R6208:Myo1e UTSW 9 70376605 missense probably damaging 0.99
R6907:Myo1e UTSW 9 70327155 missense probably benign
R7084:Myo1e UTSW 9 70337801 missense probably damaging 0.96
R7313:Myo1e UTSW 9 70359385 critical splice donor site probably null
R7383:Myo1e UTSW 9 70297295 missense probably damaging 1.00
R7811:Myo1e UTSW 9 70327262 missense probably damaging 0.96
X0021:Myo1e UTSW 9 70378273 missense probably damaging 0.99
X0065:Myo1e UTSW 9 70378294 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CCTGATGAAATGATCACAAGTGAAG -3'
(R):5'- GAGGTGAAATATTACCCAGATGTG -3'

Sequencing Primer
(F):5'- CCTAAAATGCCTAATTGTTTTCAGTG -3'
(R):5'- CCCAGTCTTTAGGCTTCTTGGTT -3'
Posted On2016-05-10