Mutagenetix > Incidental Mutations

Incidental Mutation 'R4995:Myo1e'

385185

Institutional Source

Beutler Lab

Gene Symbol

Myo1e

Ensembl Gene

ENSMUSG00000032220

Gene Name

myosin IE

Synonyms

2310020N23Rik, 9130023P14Rik

MMRRC Submission

042589-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4995 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70207350-70399766 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 70353272 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Asparagine at position 571 (D571N)

Ref Sequence

ENSEMBL: ENSMUSP00000034745 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034745] [ENSMUST00000214042]

PDB Structure

MYOSIN 1E SH3 [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000034745
AA Change: D571N

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000034745
Gene: ENSMUSG00000032220
AA Change: D571N

Domain	Start	End	E-Value	Type
MYSc	13	693	N/A	SMART
Pfam:Myosin_TH1	719	917	1e-55	PFAM
SH3	1053	1107	2.12e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000214042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000214767

Meta Mutation Damage Score

0.1277

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nonmuscle class I myosins which are a subgroup of the unconventional myosin protein family. The unconventional myosin proteins function as actin-based molecular motors. Class I myosins are characterized by a head (motor) domain, a regulatory domain and a either a short or long tail domain. Among the class I myosins, this protein is distinguished by a long tail domain that is involved in crosslinking actin filaments. This protein localizes to the cytoplasm and may be involved in intracellular movement and membrane trafficking. Mutations in this gene are the cause of focal segmental glomerulosclerosis-6. This gene has been referred to as myosin IC in the literature but is distinct from the myosin IC gene located on chromosome 17. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygotes for a gene trapped allele exhibit embryonic lethality, embryonic hemorrhaging and hematopoietic defects. Homozygotes for a knock-out allele show proteinuria, chronic renal injury, kidney inflammation, and defects in renal filtration and podocyte organization. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	G	A	2: 19,494,184	Q333*	probably null	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Acvrl1	G	A	15: 101,135,860	R141H	probably benign	Het
Adprm	A	G	11: 67,041,610	F158L	possibly damaging	Het
Aldoart2	C	T	12: 55,566,253	T321M	probably benign	Het
Ap3m2	A	G	8: 22,803,776	V86A	probably benign	Het
Arhgef19	T	A	4: 141,247,515		probably null	Het
Armc4	G	A	18: 7,223,663	T460M	probably damaging	Het
Bcl2l12	T	G	7: 44,994,191		probably null	Het
Bptf	T	C	11: 107,054,565	Q2501R	probably damaging	Het
C230029F24Rik	A	T	1: 49,338,136		noncoding transcript	Het
C7	C	T	15: 5,049,592	G78D	probably damaging	Het
Caly	T	C	7: 140,070,625	T135A	probably benign	Het
Cbl	A	G	9: 44,153,811	M740T	possibly damaging	Het
Cbx4	A	G	11: 119,081,211	V446A	probably benign	Het
Celsr1	C	A	15: 85,937,911	R1735L	probably damaging	Het
Cep250	A	G	2: 155,988,316	D135G	probably damaging	Het
Cgn	T	C	3: 94,779,936	T19A	probably damaging	Het
Chic2	A	T	5: 75,044,204	V32D	probably damaging	Het
Cntln	A	G	4: 85,049,883	K780E	probably benign	Het
Col8a2	A	T	4: 126,310,788	D197V	probably damaging	Het
Crot	A	T	5: 8,974,000	V372E	probably damaging	Het
Cyb561d2	C	T	9: 107,541,548	V26M	probably damaging	Het
Ddx5	G	A	11: 106,785,236	T237I	probably damaging	Het
Dmxl2	G	T	9: 54,501,441		probably benign	Het
Dock8	T	A	19: 25,158,383	S1188R	probably benign	Het
Ehbp1	T	A	11: 22,101,073	H493L	probably damaging	Het
Eif5b	T	A	1: 38,051,711	*1217K	probably null	Het
Eprs	A	G	1: 185,410,139		probably benign	Het
Etfdh	T	C	3: 79,605,788	D376G	probably benign	Het
Fam186a	T	C	15: 99,945,099	Q1088R	probably benign	Het
Fbxw16	G	T	9: 109,441,250	T141N	probably damaging	Het
Fgf11	G	A	11: 69,798,759	H138Y	probably damaging	Het
Gm1673	G	A	5: 33,984,926	R79H	probably damaging	Het
Htra3	T	C	5: 35,671,074	E154G	probably damaging	Het
Hydin	T	A	8: 110,569,642	V3601D	probably damaging	Het
Jup	G	T	11: 100,379,541	S380*	probably null	Het
Klrg1	T	A	6: 122,278,275	D66V	probably benign	Het
Llgl1	C	T	11: 60,709,724	A633V	probably benign	Het
Lmln	T	A	16: 33,074,097	Y203*	probably null	Het
Lrrc58	T	G	16: 37,877,056	C165G	probably benign	Het
Lss	T	C	10: 76,547,537	V557A	probably benign	Het
Mast4	T	C	13: 102,905,754		probably benign	Het
Med13l	C	A	5: 118,730,949	P754Q	possibly damaging	Het
Mga	C	T	2: 119,932,582	R1240*	probably null	Het
Mgat5b	T	A	11: 116,974,199		probably null	Het
Mtor	A	G	4: 148,525,752	D1572G	probably damaging	Het
Muc4	T	A	16: 32,754,214	S1363T	probably benign	Het
Muc4	T	A	16: 32,754,041	S1306T	probably benign	Het
Myo18b	A	G	5: 112,760,392	V2005A	probably damaging	Het
Mypn	T	C	10: 63,119,968		probably null	Het
Ndufb10	T	C	17: 24,722,757		probably null	Het
Nelfb	G	T	2: 25,206,196	D300E	probably benign	Het
Olfr1389	T	A	11: 49,430,655	Y60N	probably damaging	Het
Olfr1507	A	T	14: 52,490,531	C61*	probably null	Het
Olfr625-ps1	T	A	7: 103,683,367	D206E	probably damaging	Het
Olfr668	T	A	7: 104,925,735	T10S	probably benign	Het
Pcdha11	C	T	18: 37,011,027	T57M	probably benign	Het
Pkp1	A	T	1: 135,880,855	I458N	possibly damaging	Het
Prr12	T	A	7: 45,051,229		probably benign	Het
Prrc2c	A	T	1: 162,705,310		probably benign	Het
Psd4	T	C	2: 24,397,247	F397S	probably benign	Het
Pygm	T	C	19: 6,398,139	I737T	probably damaging	Het
Rfx1	T	A	8: 84,080,114		probably null	Het
Rsl1	A	G	13: 67,182,249	T254A	possibly damaging	Het
Sh3rf3	A	G	10: 59,086,824	Q574R	probably benign	Het
Spire1	T	C	18: 67,552,779		probably null	Het
St6galnac4	G	A	2: 32,594,063	G91D	probably damaging	Het
Sytl2	T	C	7: 90,382,257		probably benign	Het
Tbpl2	T	A	2: 24,093,860	K188N	possibly damaging	Het
Tenm3	A	T	8: 48,229,137	M2486K	possibly damaging	Het
Tgoln1	A	C	6: 72,616,140	V119G	possibly damaging	Het
Tpgs1	A	T	10: 79,669,491	N28Y	probably benign	Het
U2surp	A	C	9: 95,462,794		probably benign	Het
Vmn2r103	A	G	17: 19,773,511	H50R	probably benign	Het
Vmn2r19	A	G	6: 123,329,910	N459S	probably benign	Het
Vmn2r72	T	C	7: 85,738,485	S624G	probably damaging	Het
Vps13c	A	G	9: 67,919,321	T1415A	probably benign	Het
Vwa5b1	G	A	4: 138,608,843	P147S	probably damaging	Het

Other mutations in Myo1e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00817:Myo1e	APN	9	70342148	missense	probably benign	0.01
IGL00833:Myo1e	APN	9	70338778	missense	probably damaging	0.99
IGL00973:Myo1e	APN	9	70338787	missense	probably damaging	1.00
IGL01011:Myo1e	APN	9	70316589	splice site	probably benign
IGL01401:Myo1e	APN	9	70327166	missense	probably damaging	0.97
IGL01402:Myo1e	APN	9	70337766	missense	probably benign	0.02
IGL01404:Myo1e	APN	9	70337766	missense	probably benign	0.02
IGL01613:Myo1e	APN	9	70341273	splice site	probably benign
IGL01738:Myo1e	APN	9	70359370	missense	probably damaging	1.00
IGL01819:Myo1e	APN	9	70343040	splice site	probably benign
IGL02233:Myo1e	APN	9	70383799	splice site	probably benign
IGL02244:Myo1e	APN	9	70367689	missense	probably benign	0.00
IGL02440:Myo1e	APN	9	70346740	missense	probably damaging	1.00
IGL02806:Myo1e	APN	9	70362270	missense	probably benign	0.01
IGL02886:Myo1e	APN	9	70368773	missense	probably benign	0.00
IGL03178:Myo1e	APN	9	70286949	missense	possibly damaging	0.47
I2288:Myo1e	UTSW	9	70342097	missense	possibly damaging	0.80
R0036:Myo1e	UTSW	9	70341308	missense	probably damaging	1.00
R0238:Myo1e	UTSW	9	70342126	missense	possibly damaging	0.86
R0238:Myo1e	UTSW	9	70342126	missense	possibly damaging	0.86
R0399:Myo1e	UTSW	9	70301793	splice site	probably benign
R0526:Myo1e	UTSW	9	70322398	missense	probably damaging	1.00
R0599:Myo1e	UTSW	9	70376660	splice site	probably benign
R0656:Myo1e	UTSW	9	70367674	missense	probably damaging	1.00
R1078:Myo1e	UTSW	9	70383999	missense	probably benign
R1278:Myo1e	UTSW	9	70398785	missense	probably damaging	1.00
R1300:Myo1e	UTSW	9	70301783	missense	probably damaging	1.00
R1329:Myo1e	UTSW	9	70338738	missense	possibly damaging	0.96
R1349:Myo1e	UTSW	9	70287069	splice site	probably benign
R1463:Myo1e	UTSW	9	70338756	missense	possibly damaging	0.88
R1656:Myo1e	UTSW	9	70395934	missense	probably damaging	1.00
R1727:Myo1e	UTSW	9	70376524	missense	possibly damaging	0.88
R1789:Myo1e	UTSW	9	70338784	missense	probably damaging	1.00
R1970:Myo1e	UTSW	9	70368773	missense	probably benign	0.00
R2029:Myo1e	UTSW	9	70368687	missense	possibly damaging	0.78
R2029:Myo1e	UTSW	9	70378715	splice site	probably benign
R2039:Myo1e	UTSW	9	70320133	missense	possibly damaging	0.89
R2076:Myo1e	UTSW	9	70383877	missense	probably benign
R2256:Myo1e	UTSW	9	70378373	splice site	probably null
R2257:Myo1e	UTSW	9	70378373	splice site	probably null
R2323:Myo1e	UTSW	9	70378758	nonsense	probably null
R2443:Myo1e	UTSW	9	70327172	missense	probably benign
R4023:Myo1e	UTSW	9	70324875	missense	probably benign
R4024:Myo1e	UTSW	9	70324875	missense	probably benign
R4025:Myo1e	UTSW	9	70324875	missense	probably benign
R4026:Myo1e	UTSW	9	70324875	missense	probably benign
R4151:Myo1e	UTSW	9	70297351	nonsense	probably null
R4764:Myo1e	UTSW	9	70343135	splice site	probably null
R4768:Myo1e	UTSW	9	70370469	missense	possibly damaging	0.63
R4911:Myo1e	UTSW	9	70343096	missense	probably benign
R4999:Myo1e	UTSW	9	70353312	missense	probably damaging	1.00
R5228:Myo1e	UTSW	9	70322358	splice site	probably null
R5414:Myo1e	UTSW	9	70322358	splice site	probably null
R5577:Myo1e	UTSW	9	70370471	missense	probably benign	0.31
R5851:Myo1e	UTSW	9	70383804	missense	probably benign	0.17
R6208:Myo1e	UTSW	9	70376605	missense	probably damaging	0.99
R6907:Myo1e	UTSW	9	70327155	missense	probably benign
R7084:Myo1e	UTSW	9	70337801	missense	probably damaging	0.96
R7313:Myo1e	UTSW	9	70359385	critical splice donor site	probably null
R7383:Myo1e	UTSW	9	70297295	missense	probably damaging	1.00
R7811:Myo1e	UTSW	9	70327262	missense	probably damaging	0.96
R7962:Myo1e	UTSW	9	70335219	missense	possibly damaging	0.64
R8309:Myo1e	UTSW	9	70346763	missense	possibly damaging	0.90
R8510:Myo1e	UTSW	9	70335265	missense	probably damaging	1.00
R8513:Myo1e	UTSW	9	70320088	missense	probably damaging	1.00
X0021:Myo1e	UTSW	9	70378273	missense	probably damaging	0.99
X0065:Myo1e	UTSW	9	70378294	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- CCTGATGAAATGATCACAAGTGAAG -3'
(R):5'- GAGGTGAAATATTACCCAGATGTG -3'

Sequencing Primer
(F):5'- CCTAAAATGCCTAATTGTTTTCAGTG -3'
(R):5'- CCCAGTCTTTAGGCTTCTTGGTT -3'

Posted On

2016-05-10