Incidental Mutation 'R4995:Ehbp1'
ID 385192
Institutional Source Beutler Lab
Gene Symbol Ehbp1
Ensembl Gene ENSMUSG00000042302
Gene Name EH domain binding protein 1
Synonyms Flj21950, KIAA0903-like
MMRRC Submission 042589-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.829) question?
Stock # R4995 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 21955825-22237086 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22051073 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 493 (H493L)
Ref Sequence ENSEMBL: ENSMUSP00000105191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045167] [ENSMUST00000109563] [ENSMUST00000180360]
AlphaFold Q69ZW3
Predicted Effect probably damaging
Transcript: ENSMUST00000045167
AA Change: H468L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037489
Gene: ENSMUSG00000042302
AA Change: H468L

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109563
AA Change: H493L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105191
Gene: ENSMUSG00000042302
AA Change: H493L

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 1.3e-29 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 357 368 N/A INTRINSIC
low complexity region 399 417 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
CH 455 553 1.42e-15 SMART
Blast:CH 782 851 3e-12 BLAST
low complexity region 854 875 N/A INTRINSIC
low complexity region 908 923 N/A INTRINSIC
DUF3585 1068 1212 4.25e-61 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000180360
AA Change: H468L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136697
Gene: ENSMUSG00000042302
AA Change: H468L

DomainStartEndE-ValueType
Pfam:NT-C2 12 165 3.8e-32 PFAM
Blast:DUF3585 176 285 7e-6 BLAST
low complexity region 332 343 N/A INTRINSIC
low complexity region 374 392 N/A INTRINSIC
low complexity region 411 422 N/A INTRINSIC
CH 430 528 1.42e-15 SMART
Blast:CH 757 826 3e-12 BLAST
low complexity region 829 850 N/A INTRINSIC
low complexity region 883 898 N/A INTRINSIC
DUF3585 1043 1187 4.25e-61 SMART
Meta Mutation Damage Score 0.9606 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an Eps15 homology domain binding protein. The encoded protein may play a role in endocytic trafficking. A single nucleotide polymorphism in this gene is associated with an aggressive form of prostate cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,498,995 (GRCm39) Q333* probably null Het
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Acvrl1 G A 15: 101,033,741 (GRCm39) R141H probably benign Het
Adprm A G 11: 66,932,436 (GRCm39) F158L possibly damaging Het
Aldoart2 C T 12: 55,613,038 (GRCm39) T321M probably benign Het
Ap3m2 A G 8: 23,293,792 (GRCm39) V86A probably benign Het
Arhgef19 T A 4: 140,974,826 (GRCm39) probably null Het
Bcl2l12 T G 7: 44,643,615 (GRCm39) probably null Het
Bptf T C 11: 106,945,391 (GRCm39) Q2501R probably damaging Het
C230029F24Rik A T 1: 49,377,295 (GRCm39) noncoding transcript Het
C7 C T 15: 5,079,074 (GRCm39) G78D probably damaging Het
Caly T C 7: 139,650,538 (GRCm39) T135A probably benign Het
Cbl A G 9: 44,065,108 (GRCm39) M740T possibly damaging Het
Cbx4 A G 11: 118,972,037 (GRCm39) V446A probably benign Het
Celsr1 C A 15: 85,822,112 (GRCm39) R1735L probably damaging Het
Cep250 A G 2: 155,830,236 (GRCm39) D135G probably damaging Het
Cgn T C 3: 94,687,246 (GRCm39) T19A probably damaging Het
Chic2 A T 5: 75,204,865 (GRCm39) V32D probably damaging Het
Cntln A G 4: 84,968,120 (GRCm39) K780E probably benign Het
Col8a2 A T 4: 126,204,581 (GRCm39) D197V probably damaging Het
Crot A T 5: 9,024,000 (GRCm39) V372E probably damaging Het
Cyb561d2 C T 9: 107,418,747 (GRCm39) V26M probably damaging Het
Ddx5 G A 11: 106,676,062 (GRCm39) T237I probably damaging Het
Dmxl2 G T 9: 54,408,725 (GRCm39) probably benign Het
Dock8 T A 19: 25,135,747 (GRCm39) S1188R probably benign Het
Eif5b T A 1: 38,090,792 (GRCm39) *1217K probably null Het
Eprs1 A G 1: 185,142,336 (GRCm39) probably benign Het
Etfdh T C 3: 79,513,095 (GRCm39) D376G probably benign Het
Fam186a T C 15: 99,842,980 (GRCm39) Q1088R probably benign Het
Fbxw16 G T 9: 109,270,318 (GRCm39) T141N probably damaging Het
Fgf11 G A 11: 69,689,585 (GRCm39) H138Y probably damaging Het
Htra3 T C 5: 35,828,418 (GRCm39) E154G probably damaging Het
Hydin T A 8: 111,296,274 (GRCm39) V3601D probably damaging Het
Jup G T 11: 100,270,367 (GRCm39) S380* probably null Het
Klrg1 T A 6: 122,255,234 (GRCm39) D66V probably benign Het
Llgl1 C T 11: 60,600,550 (GRCm39) A633V probably benign Het
Lmln T A 16: 32,894,467 (GRCm39) Y203* probably null Het
Lrrc58 T G 16: 37,697,418 (GRCm39) C165G probably benign Het
Lss T C 10: 76,383,371 (GRCm39) V557A probably benign Het
Mast4 T C 13: 103,042,262 (GRCm39) probably benign Het
Med13l C A 5: 118,869,014 (GRCm39) P754Q possibly damaging Het
Mga C T 2: 119,763,063 (GRCm39) R1240* probably null Het
Mgat5b T A 11: 116,865,025 (GRCm39) probably null Het
Mtor A G 4: 148,610,209 (GRCm39) D1572G probably damaging Het
Muc4 T A 16: 32,754,214 (GRCm38) S1363T probably benign Het
Muc4 T A 16: 32,575,332 (GRCm39) S1306T probably benign Het
Myo18b A G 5: 112,908,258 (GRCm39) V2005A probably damaging Het
Myo1e G A 9: 70,260,554 (GRCm39) D571N probably benign Het
Mypn T C 10: 62,955,747 (GRCm39) probably null Het
Ndufb10 T C 17: 24,941,731 (GRCm39) probably null Het
Nelfb G T 2: 25,096,208 (GRCm39) D300E probably benign Het
Nicol1 G A 5: 34,142,270 (GRCm39) R79H probably damaging Het
Odad2 G A 18: 7,223,663 (GRCm39) T460M probably damaging Het
Or2y1d T A 11: 49,321,482 (GRCm39) Y60N probably damaging Het
Or4e5 A T 14: 52,727,988 (GRCm39) C61* probably null Het
Or52n2c T A 7: 104,574,942 (GRCm39) T10S probably benign Het
Or52z15 T A 7: 103,332,574 (GRCm39) D206E probably damaging Het
Pcdha11 C T 18: 37,144,080 (GRCm39) T57M probably benign Het
Pkp1 A T 1: 135,808,593 (GRCm39) I458N possibly damaging Het
Prr12 T A 7: 44,700,653 (GRCm39) probably benign Het
Prrc2c A T 1: 162,532,879 (GRCm39) probably benign Het
Psd4 T C 2: 24,287,259 (GRCm39) F397S probably benign Het
Pygm T C 19: 6,448,169 (GRCm39) I737T probably damaging Het
Rfx1 T A 8: 84,806,743 (GRCm39) probably null Het
Rsl1 A G 13: 67,330,313 (GRCm39) T254A possibly damaging Het
Sh3rf3 A G 10: 58,922,646 (GRCm39) Q574R probably benign Het
Spire1 T C 18: 67,685,849 (GRCm39) probably null Het
St6galnac4 G A 2: 32,484,075 (GRCm39) G91D probably damaging Het
Sytl2 T C 7: 90,031,465 (GRCm39) probably benign Het
Tbpl2 T A 2: 23,983,872 (GRCm39) K188N possibly damaging Het
Tenm3 A T 8: 48,682,172 (GRCm39) M2486K possibly damaging Het
Tgoln1 A C 6: 72,593,123 (GRCm39) V119G possibly damaging Het
Tpgs1 A T 10: 79,505,325 (GRCm39) N28Y probably benign Het
U2surp A C 9: 95,344,847 (GRCm39) probably benign Het
Vmn2r103 A G 17: 19,993,773 (GRCm39) H50R probably benign Het
Vmn2r19 A G 6: 123,306,869 (GRCm39) N459S probably benign Het
Vmn2r72 T C 7: 85,387,693 (GRCm39) S624G probably damaging Het
Vps13c A G 9: 67,826,603 (GRCm39) T1415A probably benign Het
Vwa5b1 G A 4: 138,336,154 (GRCm39) P147S probably damaging Het
Other mutations in Ehbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Ehbp1 APN 11 22,197,967 (GRCm39) splice site probably benign
IGL00786:Ehbp1 APN 11 22,050,460 (GRCm39) missense possibly damaging 0.79
IGL01308:Ehbp1 APN 11 22,088,022 (GRCm39) missense probably damaging 1.00
IGL01322:Ehbp1 APN 11 22,039,636 (GRCm39) missense probably damaging 1.00
IGL01590:Ehbp1 APN 11 22,045,611 (GRCm39) missense possibly damaging 0.91
IGL01611:Ehbp1 APN 11 22,122,883 (GRCm39) missense probably damaging 0.98
IGL01636:Ehbp1 APN 11 22,039,584 (GRCm39) missense probably benign 0.03
IGL01728:Ehbp1 APN 11 22,051,115 (GRCm39) missense probably damaging 1.00
IGL02012:Ehbp1 APN 11 22,051,218 (GRCm39) missense probably damaging 1.00
IGL02034:Ehbp1 APN 11 22,235,486 (GRCm39) critical splice donor site probably null
IGL02324:Ehbp1 APN 11 22,046,048 (GRCm39) missense probably damaging 1.00
IGL02511:Ehbp1 APN 11 22,039,653 (GRCm39) missense probably damaging 1.00
trajan UTSW 11 22,101,850 (GRCm39) missense probably damaging 1.00
K7894:Ehbp1 UTSW 11 22,039,683 (GRCm39) splice site probably benign
PIT4418001:Ehbp1 UTSW 11 22,003,494 (GRCm39) missense probably damaging 1.00
R0218:Ehbp1 UTSW 11 22,181,992 (GRCm39) splice site probably benign
R0294:Ehbp1 UTSW 11 22,045,427 (GRCm39) missense probably benign 0.27
R0398:Ehbp1 UTSW 11 22,045,886 (GRCm39) missense probably damaging 0.99
R0420:Ehbp1 UTSW 11 22,101,836 (GRCm39) missense probably benign
R0468:Ehbp1 UTSW 11 22,119,184 (GRCm39) splice site probably benign
R0943:Ehbp1 UTSW 11 22,045,883 (GRCm39) missense probably benign 0.12
R1181:Ehbp1 UTSW 11 22,012,831 (GRCm39) missense probably benign 0.25
R1481:Ehbp1 UTSW 11 21,956,782 (GRCm39) makesense probably null
R1493:Ehbp1 UTSW 11 21,956,866 (GRCm39) missense probably damaging 1.00
R1563:Ehbp1 UTSW 11 22,009,231 (GRCm39) missense probably damaging 1.00
R1648:Ehbp1 UTSW 11 22,046,000 (GRCm39) missense probably damaging 1.00
R1656:Ehbp1 UTSW 11 22,096,694 (GRCm39) missense probably benign
R1696:Ehbp1 UTSW 11 22,003,441 (GRCm39) missense probably damaging 0.99
R1923:Ehbp1 UTSW 11 22,101,850 (GRCm39) missense probably damaging 1.00
R1950:Ehbp1 UTSW 11 22,009,228 (GRCm39) missense probably damaging 1.00
R2263:Ehbp1 UTSW 11 22,045,462 (GRCm39) missense probably benign
R2436:Ehbp1 UTSW 11 22,039,524 (GRCm39) critical splice donor site probably null
R3148:Ehbp1 UTSW 11 22,050,465 (GRCm39) missense probably damaging 1.00
R3973:Ehbp1 UTSW 11 22,087,867 (GRCm39) missense probably benign 0.00
R3974:Ehbp1 UTSW 11 22,087,867 (GRCm39) missense probably benign 0.00
R4030:Ehbp1 UTSW 11 22,235,498 (GRCm39) missense probably damaging 1.00
R4085:Ehbp1 UTSW 11 22,045,898 (GRCm39) missense possibly damaging 0.95
R4089:Ehbp1 UTSW 11 22,045,898 (GRCm39) missense possibly damaging 0.95
R4524:Ehbp1 UTSW 11 22,101,843 (GRCm39) missense probably damaging 1.00
R4641:Ehbp1 UTSW 11 22,045,892 (GRCm39) missense probably benign 0.00
R4873:Ehbp1 UTSW 11 22,051,164 (GRCm39) missense probably damaging 1.00
R4875:Ehbp1 UTSW 11 22,051,164 (GRCm39) missense probably damaging 1.00
R4914:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4915:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4916:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4917:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4918:Ehbp1 UTSW 11 22,096,592 (GRCm39) missense probably benign 0.20
R4929:Ehbp1 UTSW 11 22,189,169 (GRCm39) missense possibly damaging 0.48
R5325:Ehbp1 UTSW 11 22,045,370 (GRCm39) missense possibly damaging 0.93
R5579:Ehbp1 UTSW 11 22,087,846 (GRCm39) missense probably damaging 1.00
R5979:Ehbp1 UTSW 11 22,101,887 (GRCm39) missense probably benign 0.06
R6025:Ehbp1 UTSW 11 22,189,156 (GRCm39) missense probably damaging 1.00
R6259:Ehbp1 UTSW 11 22,235,684 (GRCm39) start gained probably benign
R6685:Ehbp1 UTSW 11 22,096,641 (GRCm39) missense probably benign 0.01
R6893:Ehbp1 UTSW 11 21,964,945 (GRCm39) missense probably damaging 1.00
R7127:Ehbp1 UTSW 11 22,003,529 (GRCm39) nonsense probably null
R7465:Ehbp1 UTSW 11 22,088,001 (GRCm39) missense probably benign
R7722:Ehbp1 UTSW 11 22,039,572 (GRCm39) missense probably null
R7724:Ehbp1 UTSW 11 22,039,572 (GRCm39) missense probably null
R7797:Ehbp1 UTSW 11 22,046,109 (GRCm39) missense possibly damaging 0.79
R7868:Ehbp1 UTSW 11 22,096,542 (GRCm39) nonsense probably null
R8088:Ehbp1 UTSW 11 22,039,572 (GRCm39) missense probably null
R8218:Ehbp1 UTSW 11 22,046,096 (GRCm39) missense possibly damaging 0.77
R8235:Ehbp1 UTSW 11 22,189,153 (GRCm39) missense probably damaging 1.00
R8267:Ehbp1 UTSW 11 22,096,562 (GRCm39) missense probably benign 0.02
R8318:Ehbp1 UTSW 11 22,087,980 (GRCm39) missense probably benign 0.05
R8334:Ehbp1 UTSW 11 21,957,170 (GRCm39) missense probably damaging 1.00
R8425:Ehbp1 UTSW 11 21,963,495 (GRCm39) missense probably damaging 1.00
R8439:Ehbp1 UTSW 11 22,046,109 (GRCm39) missense possibly damaging 0.79
R8493:Ehbp1 UTSW 11 22,235,842 (GRCm39) start gained probably benign
R8745:Ehbp1 UTSW 11 22,119,064 (GRCm39) missense possibly damaging 0.78
R8824:Ehbp1 UTSW 11 22,182,053 (GRCm39) missense probably damaging 0.98
R8964:Ehbp1 UTSW 11 22,101,154 (GRCm39) nonsense probably null
R8987:Ehbp1 UTSW 11 22,003,531 (GRCm39) missense probably damaging 1.00
R9144:Ehbp1 UTSW 11 22,018,463 (GRCm39) missense probably damaging 1.00
R9187:Ehbp1 UTSW 11 22,101,184 (GRCm39) missense probably damaging 0.99
R9448:Ehbp1 UTSW 11 22,087,881 (GRCm39) missense probably benign
R9549:Ehbp1 UTSW 11 22,012,788 (GRCm39) missense probably benign 0.44
R9612:Ehbp1 UTSW 11 22,119,124 (GRCm39) missense probably damaging 0.99
R9645:Ehbp1 UTSW 11 22,051,052 (GRCm39) missense probably damaging 1.00
R9678:Ehbp1 UTSW 11 22,101,108 (GRCm39) missense possibly damaging 0.89
R9745:Ehbp1 UTSW 11 22,096,692 (GRCm39) missense probably benign 0.19
RF016:Ehbp1 UTSW 11 22,096,646 (GRCm39) missense probably benign
RF037:Ehbp1 UTSW 11 21,956,783 (GRCm39) small deletion probably benign
X0018:Ehbp1 UTSW 11 22,051,085 (GRCm39) missense probably damaging 1.00
Z1176:Ehbp1 UTSW 11 22,045,590 (GRCm39) missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAAAGGTTGGCATCCTGGC -3'
(R):5'- GTTGAAGGACCAAACTGACATC -3'

Sequencing Primer
(F):5'- GGCATCCTGGCATATACTTGTC -3'
(R):5'- GGACCAAACTGACATCAAAGGTTTC -3'
Posted On 2016-05-10