Incidental Mutation 'R4995:Olfr1389'
ID385194
Institutional Source Beutler Lab
Gene Symbol Olfr1389
Ensembl Gene ENSMUSG00000107573
Gene Nameolfactory receptor 1389
SynonymsGA_x6K02T2QP88-6004387-6003452, MOR256-1
MMRRC Submission 042589-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.294) question?
Stock #R4995 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49423067-49432968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 49430655 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 60 (Y60N)
Ref Sequence ENSEMBL: ENSMUSP00000149222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000203369] [ENSMUST00000216641] [ENSMUST00000217595]
Predicted Effect probably damaging
Transcript: ENSMUST00000185284
AA Change: Y60N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140561
Gene: ENSMUSG00000102024
AA Change: Y60N

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
Pfam:7tm_1 41 289 2.3e-30 PFAM
Pfam:7tm_4 139 282 3.8e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000203369
AA Change: Y60N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145461
Gene: ENSMUSG00000107573
AA Change: Y60N

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 1.9e-49 PFAM
Pfam:7tm_1 41 289 6.6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216641
AA Change: Y60N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000217595
AA Change: Y60N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.5970 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,494,184 Q333* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acvrl1 G A 15: 101,135,860 R141H probably benign Het
Adprm A G 11: 67,041,610 F158L possibly damaging Het
Aldoart2 C T 12: 55,566,253 T321M probably benign Het
Ap3m2 A G 8: 22,803,776 V86A probably benign Het
Arhgef19 T A 4: 141,247,515 probably null Het
Armc4 G A 18: 7,223,663 T460M probably damaging Het
Bcl2l12 T G 7: 44,994,191 probably null Het
Bptf T C 11: 107,054,565 Q2501R probably damaging Het
C230029F24Rik A T 1: 49,338,136 noncoding transcript Het
C7 C T 15: 5,049,592 G78D probably damaging Het
Caly T C 7: 140,070,625 T135A probably benign Het
Cbl A G 9: 44,153,811 M740T possibly damaging Het
Cbx4 A G 11: 119,081,211 V446A probably benign Het
Celsr1 C A 15: 85,937,911 R1735L probably damaging Het
Cep250 A G 2: 155,988,316 D135G probably damaging Het
Cgn T C 3: 94,779,936 T19A probably damaging Het
Chic2 A T 5: 75,044,204 V32D probably damaging Het
Cntln A G 4: 85,049,883 K780E probably benign Het
Col8a2 A T 4: 126,310,788 D197V probably damaging Het
Crot A T 5: 8,974,000 V372E probably damaging Het
Cyb561d2 C T 9: 107,541,548 V26M probably damaging Het
Ddx5 G A 11: 106,785,236 T237I probably damaging Het
Dmxl2 G T 9: 54,501,441 probably benign Het
Dock8 T A 19: 25,158,383 S1188R probably benign Het
Ehbp1 T A 11: 22,101,073 H493L probably damaging Het
Eif5b T A 1: 38,051,711 *1217K probably null Het
Eprs A G 1: 185,410,139 probably benign Het
Etfdh T C 3: 79,605,788 D376G probably benign Het
Fam186a T C 15: 99,945,099 Q1088R probably benign Het
Fbxw16 G T 9: 109,441,250 T141N probably damaging Het
Fgf11 G A 11: 69,798,759 H138Y probably damaging Het
Gm1673 G A 5: 33,984,926 R79H probably damaging Het
Htra3 T C 5: 35,671,074 E154G probably damaging Het
Hydin T A 8: 110,569,642 V3601D probably damaging Het
Jup G T 11: 100,379,541 S380* probably null Het
Klrg1 T A 6: 122,278,275 D66V probably benign Het
Llgl1 C T 11: 60,709,724 A633V probably benign Het
Lmln T A 16: 33,074,097 Y203* probably null Het
Lrrc58 T G 16: 37,877,056 C165G probably benign Het
Lss T C 10: 76,547,537 V557A probably benign Het
Mast4 T C 13: 102,905,754 probably benign Het
Med13l C A 5: 118,730,949 P754Q possibly damaging Het
Mga C T 2: 119,932,582 R1240* probably null Het
Mgat5b T A 11: 116,974,199 probably null Het
Mtor A G 4: 148,525,752 D1572G probably damaging Het
Muc4 T A 16: 32,754,214 S1363T probably benign Het
Muc4 T A 16: 32,754,041 S1306T probably benign Het
Myo18b A G 5: 112,760,392 V2005A probably damaging Het
Myo1e G A 9: 70,353,272 D571N probably benign Het
Mypn T C 10: 63,119,968 probably null Het
Ndufb10 T C 17: 24,722,757 probably null Het
Nelfb G T 2: 25,206,196 D300E probably benign Het
Olfr1507 A T 14: 52,490,531 C61* probably null Het
Olfr625-ps1 T A 7: 103,683,367 D206E probably damaging Het
Olfr668 T A 7: 104,925,735 T10S probably benign Het
Pcdha11 C T 18: 37,011,027 T57M probably benign Het
Pkp1 A T 1: 135,880,855 I458N possibly damaging Het
Prr12 T A 7: 45,051,229 probably benign Het
Prrc2c A T 1: 162,705,310 probably benign Het
Psd4 T C 2: 24,397,247 F397S probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rfx1 T A 8: 84,080,114 probably null Het
Rsl1 A G 13: 67,182,249 T254A possibly damaging Het
Sh3rf3 A G 10: 59,086,824 Q574R probably benign Het
Spire1 T C 18: 67,552,779 probably null Het
St6galnac4 G A 2: 32,594,063 G91D probably damaging Het
Sytl2 T C 7: 90,382,257 probably benign Het
Tbpl2 T A 2: 24,093,860 K188N possibly damaging Het
Tenm3 A T 8: 48,229,137 M2486K possibly damaging Het
Tgoln1 A C 6: 72,616,140 V119G possibly damaging Het
Tpgs1 A T 10: 79,669,491 N28Y probably benign Het
U2surp A C 9: 95,462,794 probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Vmn2r19 A G 6: 123,329,910 N459S probably benign Het
Vmn2r72 T C 7: 85,738,485 S624G probably damaging Het
Vps13c A G 9: 67,919,321 T1415A probably benign Het
Vwa5b1 G A 4: 138,608,843 P147S probably damaging Het
Other mutations in Olfr1389
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Olfr1389 APN 11 49431032 missense probably damaging 1.00
IGL02468:Olfr1389 APN 11 49431114 missense probably damaging 0.99
IGL02607:Olfr1389 APN 11 49430512 missense probably damaging 1.00
IGL02721:Olfr1389 APN 11 49430641 nonsense probably null
IGL02812:Olfr1389 APN 11 49430922 missense probably damaging 1.00
IGL03086:Olfr1389 APN 11 49430805 missense probably benign 0.03
IGL03047:Olfr1389 UTSW 11 49430967 missense probably benign 0.10
PIT4531001:Olfr1389 UTSW 11 49430926 missense probably benign 0.01
R0413:Olfr1389 UTSW 11 49431385 missense possibly damaging 0.82
R0598:Olfr1389 UTSW 11 49431403 missense probably benign 0.00
R0653:Olfr1389 UTSW 11 49431251 nonsense probably null
R1654:Olfr1389 UTSW 11 49430502 missense probably benign 0.00
R2321:Olfr1389 UTSW 11 49431280 missense probably benign 0.00
R5670:Olfr1389 UTSW 11 49431208 missense probably damaging 1.00
R6127:Olfr1389 UTSW 11 49430806 missense probably damaging 0.97
R6327:Olfr1389 UTSW 11 49431001 missense probably damaging 1.00
R6935:Olfr1389 UTSW 11 49430998 missense probably damaging 0.97
R7726:Olfr1389 UTSW 11 49430900 nonsense probably null
R7923:Olfr1389 UTSW 11 49430605 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCATCAGAGGCGTGAATGTCC -3'
(R):5'- AACGGTCAAAGGCCATGAC -3'

Sequencing Primer
(F):5'- GGCGATGGGAACTTTCAATGCC -3'
(R):5'- ATGACCCCCAGGAGCAG -3'
Posted On2016-05-10