Mutagenetix > Incidental Mutations

Incidental Mutation 'R4995:Llgl1'

385195

Institutional Source

Beutler Lab

Gene Symbol

Llgl1

Ensembl Gene

ENSMUSG00000020536

Gene Name

LLGL1 scribble cell polarity complex component

Synonyms

Lgl1

MMRRC Submission

042589-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4995 (G1)

Quality Score

205

Status

Validated

Chromosome

Chromosomal Location

60699723-60714186 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 60709724 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 633 (A633V)

Ref Sequence

ENSEMBL: ENSMUSP00000104359 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000002889] [ENSMUST00000052346] [ENSMUST00000108719]

Predicted Effect

probably benign
Transcript: ENSMUST00000002889

SMART Domains

Protein: ENSMUSP00000002889
Gene: ENSMUSG00000002812

Domain	Start	End	E-Value	Type
LRR	55	78	1.08e-1	SMART
LRR	103	126	4.08e0	SMART
LRR	127	149	2.27e1	SMART
LRR	150	173	1.25e-1	SMART
LRR	222	244	6.78e1	SMART
LRR	245	268	2.86e-1	SMART
LRR	269	291	3.78e-1	SMART
LRR	316	339	2.82e0	SMART
LRR	340	362	2.27e2	SMART
low complexity region	403	420	N/A	INTRINSIC
GEL	499	597	4.17e-25	SMART
GEL	617	709	1.72e-26	SMART
low complexity region	727	740	N/A	INTRINSIC
GEL	745	838	2.24e-25	SMART
GEL	905	1039	1.13e-3	SMART
GEL	1056	1152	7.28e-16	SMART
GEL	1167	1263	5.51e-25	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000052346
AA Change: A633V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000060749
Gene: ENSMUSG00000020536
AA Change: A633V

Domain	Start	End	E-Value	Type
WD40	22	62	4.42e1	SMART
WD40	64	103	1.65e1	SMART
WD40	187	223	2.74e2	SMART
WD40	226	264	2.06e0	SMART
Pfam:LLGL	278	379	1.2e-43	PFAM
WD40	424	460	3.2e0	SMART
Blast:WD40	498	541	2e-13	BLAST
Blast:WD40	585	624	4e-9	BLAST
Pfam:Lgl_C	732	978	1.2e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108719
AA Change: A633V

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000104359
Gene: ENSMUSG00000020536
AA Change: A633V

Domain	Start	End	E-Value	Type
WD40	22	62	4.42e1	SMART
WD40	64	103	1.65e1	SMART
WD40	187	223	2.74e2	SMART
WD40	226	264	2.06e0	SMART
Pfam:LLGL	275	379	2e-48	PFAM
WD40	424	460	3.2e0	SMART
Blast:WD40	498	540	2e-13	BLAST
Blast:WD40	585	624	4e-9	BLAST
Pfam:Lgl_C	804	976	1.3e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128749

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154141

Meta Mutation Damage Score

0.1137

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.6%

Validation Efficiency

99% (86/87)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is similar to a tumor suppressor in Drosophila. The protein is part of a cytoskeletal network and is associated with nonmuscle myosin II heavy chain and a kinase that specifically phosphorylates this protein at serine residues. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice die neonatally exhibiting hydroencephaly. Neural progenitor cell physiology is abnormal, resulting in a loss of cell polarity and the development of neuroepithelial rosette-like structures throughout the brain. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921504E06Rik	G	A	2: 19,494,184	Q333*	probably null	Het
4930505A04Rik	C	T	11: 30,426,349	V173M	probably damaging	Het
Acvrl1	G	A	15: 101,135,860	R141H	probably benign	Het
Adprm	A	G	11: 67,041,610	F158L	possibly damaging	Het
Aldoart2	C	T	12: 55,566,253	T321M	probably benign	Het
Ap3m2	A	G	8: 22,803,776	V86A	probably benign	Het
Arhgef19	T	A	4: 141,247,515		probably null	Het
Armc4	G	A	18: 7,223,663	T460M	probably damaging	Het
Bcl2l12	T	G	7: 44,994,191		probably null	Het
Bptf	T	C	11: 107,054,565	Q2501R	probably damaging	Het
C230029F24Rik	A	T	1: 49,338,136		noncoding transcript	Het
C7	C	T	15: 5,049,592	G78D	probably damaging	Het
Caly	T	C	7: 140,070,625	T135A	probably benign	Het
Cbl	A	G	9: 44,153,811	M740T	possibly damaging	Het
Cbx4	A	G	11: 119,081,211	V446A	probably benign	Het
Celsr1	C	A	15: 85,937,911	R1735L	probably damaging	Het
Cep250	A	G	2: 155,988,316	D135G	probably damaging	Het
Cgn	T	C	3: 94,779,936	T19A	probably damaging	Het
Chic2	A	T	5: 75,044,204	V32D	probably damaging	Het
Cntln	A	G	4: 85,049,883	K780E	probably benign	Het
Col8a2	A	T	4: 126,310,788	D197V	probably damaging	Het
Crot	A	T	5: 8,974,000	V372E	probably damaging	Het
Cyb561d2	C	T	9: 107,541,548	V26M	probably damaging	Het
Ddx5	G	A	11: 106,785,236	T237I	probably damaging	Het
Dmxl2	G	T	9: 54,501,441		probably benign	Het
Dock8	T	A	19: 25,158,383	S1188R	probably benign	Het
Ehbp1	T	A	11: 22,101,073	H493L	probably damaging	Het
Eif5b	T	A	1: 38,051,711	*1217K	probably null	Het
Eprs	A	G	1: 185,410,139		probably benign	Het
Etfdh	T	C	3: 79,605,788	D376G	probably benign	Het
Fam186a	T	C	15: 99,945,099	Q1088R	probably benign	Het
Fbxw16	G	T	9: 109,441,250	T141N	probably damaging	Het
Fgf11	G	A	11: 69,798,759	H138Y	probably damaging	Het
Gm1673	G	A	5: 33,984,926	R79H	probably damaging	Het
Htra3	T	C	5: 35,671,074	E154G	probably damaging	Het
Hydin	T	A	8: 110,569,642	V3601D	probably damaging	Het
Jup	G	T	11: 100,379,541	S380*	probably null	Het
Klrg1	T	A	6: 122,278,275	D66V	probably benign	Het
Lmln	T	A	16: 33,074,097	Y203*	probably null	Het
Lrrc58	T	G	16: 37,877,056	C165G	probably benign	Het
Lss	T	C	10: 76,547,537	V557A	probably benign	Het
Mast4	T	C	13: 102,905,754		probably benign	Het
Med13l	C	A	5: 118,730,949	P754Q	possibly damaging	Het
Mga	C	T	2: 119,932,582	R1240*	probably null	Het
Mgat5b	T	A	11: 116,974,199		probably null	Het
Mtor	A	G	4: 148,525,752	D1572G	probably damaging	Het
Muc4	T	A	16: 32,754,214	S1363T	probably benign	Het
Muc4	T	A	16: 32,754,041	S1306T	probably benign	Het
Myo18b	A	G	5: 112,760,392	V2005A	probably damaging	Het
Myo1e	G	A	9: 70,353,272	D571N	probably benign	Het
Mypn	T	C	10: 63,119,968		probably null	Het
Ndufb10	T	C	17: 24,722,757		probably null	Het
Nelfb	G	T	2: 25,206,196	D300E	probably benign	Het
Olfr1389	T	A	11: 49,430,655	Y60N	probably damaging	Het
Olfr1507	A	T	14: 52,490,531	C61*	probably null	Het
Olfr625-ps1	T	A	7: 103,683,367	D206E	probably damaging	Het
Olfr668	T	A	7: 104,925,735	T10S	probably benign	Het
Pcdha11	C	T	18: 37,011,027	T57M	probably benign	Het
Pkp1	A	T	1: 135,880,855	I458N	possibly damaging	Het
Prr12	T	A	7: 45,051,229		probably benign	Het
Prrc2c	A	T	1: 162,705,310		probably benign	Het
Psd4	T	C	2: 24,397,247	F397S	probably benign	Het
Pygm	T	C	19: 6,398,139	I737T	probably damaging	Het
Rfx1	T	A	8: 84,080,114		probably null	Het
Rsl1	A	G	13: 67,182,249	T254A	possibly damaging	Het
Sh3rf3	A	G	10: 59,086,824	Q574R	probably benign	Het
Spire1	T	C	18: 67,552,779		probably null	Het
St6galnac4	G	A	2: 32,594,063	G91D	probably damaging	Het
Sytl2	T	C	7: 90,382,257		probably benign	Het
Tbpl2	T	A	2: 24,093,860	K188N	possibly damaging	Het
Tenm3	A	T	8: 48,229,137	M2486K	possibly damaging	Het
Tgoln1	A	C	6: 72,616,140	V119G	possibly damaging	Het
Tpgs1	A	T	10: 79,669,491	N28Y	probably benign	Het
U2surp	A	C	9: 95,462,794		probably benign	Het
Vmn2r103	A	G	17: 19,773,511	H50R	probably benign	Het
Vmn2r19	A	G	6: 123,329,910	N459S	probably benign	Het
Vmn2r72	T	C	7: 85,738,485	S624G	probably damaging	Het
Vps13c	A	G	9: 67,919,321	T1415A	probably benign	Het
Vwa5b1	G	A	4: 138,608,843	P147S	probably damaging	Het

Other mutations in Llgl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01137:Llgl1	APN	11	60709999	missense	probably benign	0.38
IGL01400:Llgl1	APN	11	60706490	missense	probably damaging	1.00
IGL03066:Llgl1	APN	11	60706034	missense	possibly damaging	0.75
IGL03174:Llgl1	APN	11	60706210	missense	probably benign	0.15
IGL03306:Llgl1	APN	11	60711354	missense	possibly damaging	0.92
R0284:Llgl1	UTSW	11	60712141	missense	probably damaging	0.98
R1137:Llgl1	UTSW	11	60704733	missense	probably benign	0.01
R1432:Llgl1	UTSW	11	60708554	missense	probably damaging	1.00
R1769:Llgl1	UTSW	11	60707047	missense	probably damaging	1.00
R1786:Llgl1	UTSW	11	60707240	missense	probably benign	0.19
R1835:Llgl1	UTSW	11	60704730	missense	probably benign	0.00
R1943:Llgl1	UTSW	11	60706016	missense	probably benign
R2197:Llgl1	UTSW	11	60710039	missense	possibly damaging	0.62
R2510:Llgl1	UTSW	11	60710036	missense	probably damaging	1.00
R2568:Llgl1	UTSW	11	60708812	missense	probably damaging	1.00
R3690:Llgl1	UTSW	11	60707002	missense	probably damaging	1.00
R3853:Llgl1	UTSW	11	60707249	missense	probably damaging	1.00
R4079:Llgl1	UTSW	11	60710284	splice site	probably null
R4259:Llgl1	UTSW	11	60709568	missense	probably benign
R4348:Llgl1	UTSW	11	60709568	missense	probably benign
R4349:Llgl1	UTSW	11	60709568	missense	probably benign
R4352:Llgl1	UTSW	11	60709568	missense	probably benign
R4353:Llgl1	UTSW	11	60709568	missense	probably benign
R4396:Llgl1	UTSW	11	60706008	missense	probably benign
R4584:Llgl1	UTSW	11	60712082	missense	probably damaging	0.99
R4594:Llgl1	UTSW	11	60706321	missense	probably benign	0.15
R4628:Llgl1	UTSW	11	60709985	missense	probably damaging	1.00
R4651:Llgl1	UTSW	11	60708651	missense	possibly damaging	0.80
R4653:Llgl1	UTSW	11	60708651	missense	possibly damaging	0.80
R4731:Llgl1	UTSW	11	60706225	nonsense	probably null
R4869:Llgl1	UTSW	11	60707210	nonsense	probably null
R4898:Llgl1	UTSW	11	60709568	missense	probably benign
R4899:Llgl1	UTSW	11	60709568	missense	probably benign
R4939:Llgl1	UTSW	11	60709979	critical splice acceptor site	probably null
R4941:Llgl1	UTSW	11	60709568	missense	probably benign
R4942:Llgl1	UTSW	11	60709568	missense	probably benign
R4958:Llgl1	UTSW	11	60711435	missense	probably benign	0.02
R4997:Llgl1	UTSW	11	60709568	missense	probably benign
R5177:Llgl1	UTSW	11	60712007	missense	possibly damaging	0.94
R5257:Llgl1	UTSW	11	60711563	unclassified	probably null
R5258:Llgl1	UTSW	11	60711563	unclassified	probably null
R5401:Llgl1	UTSW	11	60706471	missense	probably benign
R5406:Llgl1	UTSW	11	60713184	missense	probably damaging	0.99
R5432:Llgl1	UTSW	11	60707623	missense	probably benign
R5587:Llgl1	UTSW	11	60710342	missense	probably benign	0.00
R5732:Llgl1	UTSW	11	60709460	missense	probably benign	0.00
R5758:Llgl1	UTSW	11	60708567	missense	probably damaging	1.00
R5879:Llgl1	UTSW	11	60712980	missense	probably benign	0.00
R6268:Llgl1	UTSW	11	60712163	missense	probably benign	0.13
R6286:Llgl1	UTSW	11	60709532	missense	probably damaging	1.00
R6455:Llgl1	UTSW	11	60709660	missense	probably damaging	0.98
R6805:Llgl1	UTSW	11	60702865	missense	probably benign	0.25
R6929:Llgl1	UTSW	11	60710353	nonsense	probably null
R7274:Llgl1	UTSW	11	60705986	missense	possibly damaging	0.89
R7889:Llgl1	UTSW	11	60707312	missense	probably damaging	1.00
R7972:Llgl1	UTSW	11	60707312	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTTCTTCAGGATCGCGAGG -3'
(R):5'- TGGCCAAAGAATCATTGGGG -3'

Sequencing Primer
(F):5'- TTCACGTGGAAGGGTCACG -3'
(R):5'- TGGAGCTACACTGCACTCCTG -3'

Posted On

2016-05-10