Incidental Mutation 'R4995:Fgf11'
ID 385197
Institutional Source Beutler Lab
Gene Symbol Fgf11
Ensembl Gene ENSMUSG00000042826
Gene Name fibroblast growth factor 11
Synonyms Fhf3
MMRRC Submission 042589-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.567) question?
Stock # R4995 (G1)
Quality Score 203
Status Validated
Chromosome 11
Chromosomal Location 69686894-69692683 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 69689585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 138 (H138Y)
Ref Sequence ENSEMBL: ENSMUSP00000099645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011285] [ENSMUST00000045971] [ENSMUST00000051025] [ENSMUST00000102585]
AlphaFold P70378
Predicted Effect probably benign
Transcript: ENSMUST00000011285
SMART Domains Protein: ENSMUSP00000011285
Gene: ENSMUSG00000042826

DomainStartEndE-ValueType
FGF 69 172 6.95e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000045971
SMART Domains Protein: ENSMUSP00000047270
Gene: ENSMUSG00000041189

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Neur_chan_LBD 27 245 3.6e-65 PFAM
Pfam:Neur_chan_memb 252 487 3.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000051025
SMART Domains Protein: ENSMUSP00000132164
Gene: ENSMUSG00000089876

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Mab-21 191 494 3.31e-43 SMART
low complexity region 498 507 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102585
AA Change: H138Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099645
Gene: ENSMUSG00000042826
AA Change: H138Y

DomainStartEndE-ValueType
FGF 69 200 3.43e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129381
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147791
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154816
Meta Mutation Damage Score 0.1065 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes, including embryonic development, cell growth, morphogenesis, tissue repair, tumor growth and invasion. The function of this gene has not yet been determined. The expression pattern of the mouse homolog implies a role in nervous system development. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,498,995 (GRCm39) Q333* probably null Het
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Acvrl1 G A 15: 101,033,741 (GRCm39) R141H probably benign Het
Adprm A G 11: 66,932,436 (GRCm39) F158L possibly damaging Het
Aldoart2 C T 12: 55,613,038 (GRCm39) T321M probably benign Het
Ap3m2 A G 8: 23,293,792 (GRCm39) V86A probably benign Het
Arhgef19 T A 4: 140,974,826 (GRCm39) probably null Het
Bcl2l12 T G 7: 44,643,615 (GRCm39) probably null Het
Bptf T C 11: 106,945,391 (GRCm39) Q2501R probably damaging Het
C230029F24Rik A T 1: 49,377,295 (GRCm39) noncoding transcript Het
C7 C T 15: 5,079,074 (GRCm39) G78D probably damaging Het
Caly T C 7: 139,650,538 (GRCm39) T135A probably benign Het
Cbl A G 9: 44,065,108 (GRCm39) M740T possibly damaging Het
Cbx4 A G 11: 118,972,037 (GRCm39) V446A probably benign Het
Celsr1 C A 15: 85,822,112 (GRCm39) R1735L probably damaging Het
Cep250 A G 2: 155,830,236 (GRCm39) D135G probably damaging Het
Cgn T C 3: 94,687,246 (GRCm39) T19A probably damaging Het
Chic2 A T 5: 75,204,865 (GRCm39) V32D probably damaging Het
Cntln A G 4: 84,968,120 (GRCm39) K780E probably benign Het
Col8a2 A T 4: 126,204,581 (GRCm39) D197V probably damaging Het
Crot A T 5: 9,024,000 (GRCm39) V372E probably damaging Het
Cyb561d2 C T 9: 107,418,747 (GRCm39) V26M probably damaging Het
Ddx5 G A 11: 106,676,062 (GRCm39) T237I probably damaging Het
Dmxl2 G T 9: 54,408,725 (GRCm39) probably benign Het
Dock8 T A 19: 25,135,747 (GRCm39) S1188R probably benign Het
Ehbp1 T A 11: 22,051,073 (GRCm39) H493L probably damaging Het
Eif5b T A 1: 38,090,792 (GRCm39) *1217K probably null Het
Eprs1 A G 1: 185,142,336 (GRCm39) probably benign Het
Etfdh T C 3: 79,513,095 (GRCm39) D376G probably benign Het
Fam186a T C 15: 99,842,980 (GRCm39) Q1088R probably benign Het
Fbxw16 G T 9: 109,270,318 (GRCm39) T141N probably damaging Het
Htra3 T C 5: 35,828,418 (GRCm39) E154G probably damaging Het
Hydin T A 8: 111,296,274 (GRCm39) V3601D probably damaging Het
Jup G T 11: 100,270,367 (GRCm39) S380* probably null Het
Klrg1 T A 6: 122,255,234 (GRCm39) D66V probably benign Het
Llgl1 C T 11: 60,600,550 (GRCm39) A633V probably benign Het
Lmln T A 16: 32,894,467 (GRCm39) Y203* probably null Het
Lrrc58 T G 16: 37,697,418 (GRCm39) C165G probably benign Het
Lss T C 10: 76,383,371 (GRCm39) V557A probably benign Het
Mast4 T C 13: 103,042,262 (GRCm39) probably benign Het
Med13l C A 5: 118,869,014 (GRCm39) P754Q possibly damaging Het
Mga C T 2: 119,763,063 (GRCm39) R1240* probably null Het
Mgat5b T A 11: 116,865,025 (GRCm39) probably null Het
Mtor A G 4: 148,610,209 (GRCm39) D1572G probably damaging Het
Muc4 T A 16: 32,754,214 (GRCm38) S1363T probably benign Het
Muc4 T A 16: 32,575,332 (GRCm39) S1306T probably benign Het
Myo18b A G 5: 112,908,258 (GRCm39) V2005A probably damaging Het
Myo1e G A 9: 70,260,554 (GRCm39) D571N probably benign Het
Mypn T C 10: 62,955,747 (GRCm39) probably null Het
Ndufb10 T C 17: 24,941,731 (GRCm39) probably null Het
Nelfb G T 2: 25,096,208 (GRCm39) D300E probably benign Het
Nicol1 G A 5: 34,142,270 (GRCm39) R79H probably damaging Het
Odad2 G A 18: 7,223,663 (GRCm39) T460M probably damaging Het
Or2y1d T A 11: 49,321,482 (GRCm39) Y60N probably damaging Het
Or4e5 A T 14: 52,727,988 (GRCm39) C61* probably null Het
Or52n2c T A 7: 104,574,942 (GRCm39) T10S probably benign Het
Or52z15 T A 7: 103,332,574 (GRCm39) D206E probably damaging Het
Pcdha11 C T 18: 37,144,080 (GRCm39) T57M probably benign Het
Pkp1 A T 1: 135,808,593 (GRCm39) I458N possibly damaging Het
Prr12 T A 7: 44,700,653 (GRCm39) probably benign Het
Prrc2c A T 1: 162,532,879 (GRCm39) probably benign Het
Psd4 T C 2: 24,287,259 (GRCm39) F397S probably benign Het
Pygm T C 19: 6,448,169 (GRCm39) I737T probably damaging Het
Rfx1 T A 8: 84,806,743 (GRCm39) probably null Het
Rsl1 A G 13: 67,330,313 (GRCm39) T254A possibly damaging Het
Sh3rf3 A G 10: 58,922,646 (GRCm39) Q574R probably benign Het
Spire1 T C 18: 67,685,849 (GRCm39) probably null Het
St6galnac4 G A 2: 32,484,075 (GRCm39) G91D probably damaging Het
Sytl2 T C 7: 90,031,465 (GRCm39) probably benign Het
Tbpl2 T A 2: 23,983,872 (GRCm39) K188N possibly damaging Het
Tenm3 A T 8: 48,682,172 (GRCm39) M2486K possibly damaging Het
Tgoln1 A C 6: 72,593,123 (GRCm39) V119G possibly damaging Het
Tpgs1 A T 10: 79,505,325 (GRCm39) N28Y probably benign Het
U2surp A C 9: 95,344,847 (GRCm39) probably benign Het
Vmn2r103 A G 17: 19,993,773 (GRCm39) H50R probably benign Het
Vmn2r19 A G 6: 123,306,869 (GRCm39) N459S probably benign Het
Vmn2r72 T C 7: 85,387,693 (GRCm39) S624G probably damaging Het
Vps13c A G 9: 67,826,603 (GRCm39) T1415A probably benign Het
Vwa5b1 G A 4: 138,336,154 (GRCm39) P147S probably damaging Het
Other mutations in Fgf11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02867:Fgf11 APN 11 69,690,498 (GRCm39) missense possibly damaging 0.94
R0843:Fgf11 UTSW 11 69,689,602 (GRCm39) splice site probably benign
R1899:Fgf11 UTSW 11 69,692,279 (GRCm39) missense probably benign 0.03
R1900:Fgf11 UTSW 11 69,692,279 (GRCm39) missense probably benign 0.03
R3619:Fgf11 UTSW 11 69,690,234 (GRCm39) missense probably benign 0.00
R5466:Fgf11 UTSW 11 69,690,267 (GRCm39) missense probably damaging 0.97
R6589:Fgf11 UTSW 11 69,690,261 (GRCm39) missense probably damaging 1.00
R9312:Fgf11 UTSW 11 69,689,412 (GRCm39) missense probably damaging 1.00
X0018:Fgf11 UTSW 11 69,692,421 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGACCCACCTTTTCTGGAG -3'
(R):5'- TGGCTGTTTCTTCCCAAGG -3'

Sequencing Primer
(F):5'- TCCAGGAGCTTGGGCACAAAG -3'
(R):5'- AAGGGCTCCATTCTACCAGTG -3'
Posted On 2016-05-10