Incidental Mutation 'R4995:Ddx5'
ID385199
Institutional Source Beutler Lab
Gene Symbol Ddx5
Ensembl Gene ENSMUSG00000020719
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 5
SynonymsHlr1, p68, 2600009A06Rik
MMRRC Submission 042589-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4995 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106780355-106789185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106785236 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 237 (T237I)
Ref Sequence ENSEMBL: ENSMUSP00000021062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018516] [ENSMUST00000021062] [ENSMUST00000103068] [ENSMUST00000123339] [ENSMUST00000127481] [ENSMUST00000129585] [ENSMUST00000133426]
Predicted Effect probably benign
Transcript: ENSMUST00000018516
SMART Domains Protein: ENSMUSP00000018516
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
low complexity region 389 407 N/A INTRINSIC
coiled coil region 584 633 N/A INTRINSIC
coiled coil region 701 793 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000021062
AA Change: T237I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021062
Gene: ENSMUSG00000020719
AA Change: T237I

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 9e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
HELICc 355 436 3.57e-32 SMART
low complexity region 477 496 N/A INTRINSIC
Pfam:P68HR 498 532 8e-20 PFAM
Pfam:P68HR 551 583 5.2e-20 PFAM
low complexity region 592 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000103068
SMART Domains Protein: ENSMUSP00000099357
Gene: ENSMUSG00000018372

DomainStartEndE-ValueType
low complexity region 346 364 N/A INTRINSIC
coiled coil region 541 590 N/A INTRINSIC
coiled coil region 658 750 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106779
SMART Domains Protein: ENSMUSP00000102391
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 3e-38 BLAST
PDB:4A4D|A 52 86 4e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000123339
SMART Domains Protein: ENSMUSP00000121733
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 7e-37 BLAST
Pfam:DEAD 118 161 1.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127481
SMART Domains Protein: ENSMUSP00000138184
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 70 2e-26 BLAST
PDB:4A4D|A 52 70 3e-7 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000129585
SMART Domains Protein: ENSMUSP00000116859
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 8e-37 BLAST
Pfam:DEAD 118 183 7.2e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130019
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130172
Predicted Effect probably damaging
Transcript: ENSMUST00000133426
AA Change: T237I

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138237
Gene: ENSMUSG00000020719
AA Change: T237I

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 2e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
Pfam:Helicase_C 359 406 1.6e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151741
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175532
Meta Mutation Damage Score 0.1284 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is a RNA-dependent ATPase, and also a proliferation-associated nuclear antigen, specifically reacting with the simian virus 40 tumor antigen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a reporter/null allele die around E11.5 displaying blood vessel malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,494,184 Q333* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acvrl1 G A 15: 101,135,860 R141H probably benign Het
Adprm A G 11: 67,041,610 F158L possibly damaging Het
Aldoart2 C T 12: 55,566,253 T321M probably benign Het
Ap3m2 A G 8: 22,803,776 V86A probably benign Het
Arhgef19 T A 4: 141,247,515 probably null Het
Armc4 G A 18: 7,223,663 T460M probably damaging Het
Bcl2l12 T G 7: 44,994,191 probably null Het
Bptf T C 11: 107,054,565 Q2501R probably damaging Het
C230029F24Rik A T 1: 49,338,136 noncoding transcript Het
C7 C T 15: 5,049,592 G78D probably damaging Het
Caly T C 7: 140,070,625 T135A probably benign Het
Cbl A G 9: 44,153,811 M740T possibly damaging Het
Cbx4 A G 11: 119,081,211 V446A probably benign Het
Celsr1 C A 15: 85,937,911 R1735L probably damaging Het
Cep250 A G 2: 155,988,316 D135G probably damaging Het
Cgn T C 3: 94,779,936 T19A probably damaging Het
Chic2 A T 5: 75,044,204 V32D probably damaging Het
Cntln A G 4: 85,049,883 K780E probably benign Het
Col8a2 A T 4: 126,310,788 D197V probably damaging Het
Crot A T 5: 8,974,000 V372E probably damaging Het
Cyb561d2 C T 9: 107,541,548 V26M probably damaging Het
Dmxl2 G T 9: 54,501,441 probably benign Het
Dock8 T A 19: 25,158,383 S1188R probably benign Het
Ehbp1 T A 11: 22,101,073 H493L probably damaging Het
Eif5b T A 1: 38,051,711 *1217K probably null Het
Eprs A G 1: 185,410,139 probably benign Het
Etfdh T C 3: 79,605,788 D376G probably benign Het
Fam186a T C 15: 99,945,099 Q1088R probably benign Het
Fbxw16 G T 9: 109,441,250 T141N probably damaging Het
Fgf11 G A 11: 69,798,759 H138Y probably damaging Het
Gm1673 G A 5: 33,984,926 R79H probably damaging Het
Htra3 T C 5: 35,671,074 E154G probably damaging Het
Hydin T A 8: 110,569,642 V3601D probably damaging Het
Jup G T 11: 100,379,541 S380* probably null Het
Klrg1 T A 6: 122,278,275 D66V probably benign Het
Llgl1 C T 11: 60,709,724 A633V probably benign Het
Lmln T A 16: 33,074,097 Y203* probably null Het
Lrrc58 T G 16: 37,877,056 C165G probably benign Het
Lss T C 10: 76,547,537 V557A probably benign Het
Mast4 T C 13: 102,905,754 probably benign Het
Med13l C A 5: 118,730,949 P754Q possibly damaging Het
Mga C T 2: 119,932,582 R1240* probably null Het
Mgat5b T A 11: 116,974,199 probably null Het
Mtor A G 4: 148,525,752 D1572G probably damaging Het
Muc4 T A 16: 32,754,214 S1363T probably benign Het
Muc4 T A 16: 32,754,041 S1306T probably benign Het
Myo18b A G 5: 112,760,392 V2005A probably damaging Het
Myo1e G A 9: 70,353,272 D571N probably benign Het
Mypn T C 10: 63,119,968 probably null Het
Ndufb10 T C 17: 24,722,757 probably null Het
Nelfb G T 2: 25,206,196 D300E probably benign Het
Olfr1389 T A 11: 49,430,655 Y60N probably damaging Het
Olfr1507 A T 14: 52,490,531 C61* probably null Het
Olfr625-ps1 T A 7: 103,683,367 D206E probably damaging Het
Olfr668 T A 7: 104,925,735 T10S probably benign Het
Pcdha11 C T 18: 37,011,027 T57M probably benign Het
Pkp1 A T 1: 135,880,855 I458N possibly damaging Het
Prr12 T A 7: 45,051,229 probably benign Het
Prrc2c A T 1: 162,705,310 probably benign Het
Psd4 T C 2: 24,397,247 F397S probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rfx1 T A 8: 84,080,114 probably null Het
Rsl1 A G 13: 67,182,249 T254A possibly damaging Het
Sh3rf3 A G 10: 59,086,824 Q574R probably benign Het
Spire1 T C 18: 67,552,779 probably null Het
St6galnac4 G A 2: 32,594,063 G91D probably damaging Het
Sytl2 T C 7: 90,382,257 probably benign Het
Tbpl2 T A 2: 24,093,860 K188N possibly damaging Het
Tenm3 A T 8: 48,229,137 M2486K possibly damaging Het
Tgoln1 A C 6: 72,616,140 V119G possibly damaging Het
Tpgs1 A T 10: 79,669,491 N28Y probably benign Het
U2surp A C 9: 95,462,794 probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Vmn2r19 A G 6: 123,329,910 N459S probably benign Het
Vmn2r72 T C 7: 85,738,485 S624G probably damaging Het
Vps13c A G 9: 67,919,321 T1415A probably benign Het
Vwa5b1 G A 4: 138,608,843 P147S probably damaging Het
Other mutations in Ddx5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02110:Ddx5 APN 11 106785009 missense probably damaging 0.99
IGL02975:Ddx5 APN 11 106781885 missense probably benign 0.00
IGL03037:Ddx5 APN 11 106782104 missense possibly damaging 0.82
IGL03046:Ddx5 UTSW 11 106785045 missense probably damaging 1.00
R0544:Ddx5 UTSW 11 106782462 unclassified probably benign
R1186:Ddx5 UTSW 11 106783979 unclassified probably null
R1464:Ddx5 UTSW 11 106784885 missense probably benign 0.00
R1464:Ddx5 UTSW 11 106784885 missense probably benign 0.00
R1839:Ddx5 UTSW 11 106784897 missense probably benign 0.02
R3781:Ddx5 UTSW 11 106784520 missense probably benign 0.00
R3782:Ddx5 UTSW 11 106784520 missense probably benign 0.00
R4968:Ddx5 UTSW 11 106784127 missense probably damaging 1.00
R4973:Ddx5 UTSW 11 106785007 missense possibly damaging 0.94
R5839:Ddx5 UTSW 11 106782206 missense probably damaging 0.97
R6263:Ddx5 UTSW 11 106788313 missense possibly damaging 0.83
R6314:Ddx5 UTSW 11 106788521 unclassified probably benign
R6341:Ddx5 UTSW 11 106785542 splice site probably null
R6707:Ddx5 UTSW 11 106782232 missense probably benign 0.00
R7424:Ddx5 UTSW 11 106782180 missense probably benign 0.12
R7910:Ddx5 UTSW 11 106784435 missense probably damaging 1.00
R7991:Ddx5 UTSW 11 106784435 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACTCCACATTAGTGTTTGC -3'
(R):5'- GGACCACAGATTCGTGATTTG -3'

Sequencing Primer
(F):5'- CACATTAGTGTTTGCCTATCAGG -3'
(R):5'- CCACAGATTCGTGATTTGGAAAG -3'
Posted On2016-05-10