Incidental Mutation 'R4995:Olfr1507'
ID385206
Institutional Source Beutler Lab
Gene Symbol Olfr1507
Ensembl Gene ENSMUSG00000059887
Gene Nameolfactory receptor 1507
SynonymsMOR244-1, MOR28, GA_x6K02T2RJGY-491851-492792
MMRRC Submission 042589-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4995 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location52488791-52495749 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 52490531 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 61 (C61*)
Ref Sequence ENSEMBL: ENSMUSP00000145718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073571] [ENSMUST00000205963] [ENSMUST00000206062] [ENSMUST00000206069] [ENSMUST00000206931]
Predicted Effect probably null
Transcript: ENSMUST00000073571
AA Change: C144*
SMART Domains Protein: ENSMUSP00000073260
Gene: ENSMUSG00000059887
AA Change: C144*

DomainStartEndE-ValueType
Pfam:7tm_4 34 308 1.1e-47 PFAM
Pfam:7TM_GPCR_Srsx 38 305 3.6e-9 PFAM
Pfam:7tm_1 44 290 9.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000205963
AA Change: C117*
Predicted Effect probably null
Transcript: ENSMUST00000206062
AA Change: C144*
Predicted Effect probably null
Transcript: ENSMUST00000206069
AA Change: C61*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206087
AA Change: C144*
Predicted Effect probably benign
Transcript: ENSMUST00000206931
Meta Mutation Damage Score 0.9376 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,494,184 Q333* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acvrl1 G A 15: 101,135,860 R141H probably benign Het
Adprm A G 11: 67,041,610 F158L possibly damaging Het
Aldoart2 C T 12: 55,566,253 T321M probably benign Het
Ap3m2 A G 8: 22,803,776 V86A probably benign Het
Arhgef19 T A 4: 141,247,515 probably null Het
Armc4 G A 18: 7,223,663 T460M probably damaging Het
Bcl2l12 T G 7: 44,994,191 probably null Het
Bptf T C 11: 107,054,565 Q2501R probably damaging Het
C230029F24Rik A T 1: 49,338,136 noncoding transcript Het
C7 C T 15: 5,049,592 G78D probably damaging Het
Caly T C 7: 140,070,625 T135A probably benign Het
Cbl A G 9: 44,153,811 M740T possibly damaging Het
Cbx4 A G 11: 119,081,211 V446A probably benign Het
Celsr1 C A 15: 85,937,911 R1735L probably damaging Het
Cep250 A G 2: 155,988,316 D135G probably damaging Het
Cgn T C 3: 94,779,936 T19A probably damaging Het
Chic2 A T 5: 75,044,204 V32D probably damaging Het
Cntln A G 4: 85,049,883 K780E probably benign Het
Col8a2 A T 4: 126,310,788 D197V probably damaging Het
Crot A T 5: 8,974,000 V372E probably damaging Het
Cyb561d2 C T 9: 107,541,548 V26M probably damaging Het
Ddx5 G A 11: 106,785,236 T237I probably damaging Het
Dmxl2 G T 9: 54,501,441 probably benign Het
Dock8 T A 19: 25,158,383 S1188R probably benign Het
Ehbp1 T A 11: 22,101,073 H493L probably damaging Het
Eif5b T A 1: 38,051,711 *1217K probably null Het
Eprs A G 1: 185,410,139 probably benign Het
Etfdh T C 3: 79,605,788 D376G probably benign Het
Fam186a T C 15: 99,945,099 Q1088R probably benign Het
Fbxw16 G T 9: 109,441,250 T141N probably damaging Het
Fgf11 G A 11: 69,798,759 H138Y probably damaging Het
Gm1673 G A 5: 33,984,926 R79H probably damaging Het
Htra3 T C 5: 35,671,074 E154G probably damaging Het
Hydin T A 8: 110,569,642 V3601D probably damaging Het
Jup G T 11: 100,379,541 S380* probably null Het
Klrg1 T A 6: 122,278,275 D66V probably benign Het
Llgl1 C T 11: 60,709,724 A633V probably benign Het
Lmln T A 16: 33,074,097 Y203* probably null Het
Lrrc58 T G 16: 37,877,056 C165G probably benign Het
Lss T C 10: 76,547,537 V557A probably benign Het
Mast4 T C 13: 102,905,754 probably benign Het
Med13l C A 5: 118,730,949 P754Q possibly damaging Het
Mga C T 2: 119,932,582 R1240* probably null Het
Mgat5b T A 11: 116,974,199 probably null Het
Mtor A G 4: 148,525,752 D1572G probably damaging Het
Muc4 T A 16: 32,754,214 S1363T probably benign Het
Muc4 T A 16: 32,754,041 S1306T probably benign Het
Myo18b A G 5: 112,760,392 V2005A probably damaging Het
Myo1e G A 9: 70,353,272 D571N probably benign Het
Mypn T C 10: 63,119,968 probably null Het
Ndufb10 T C 17: 24,722,757 probably null Het
Nelfb G T 2: 25,206,196 D300E probably benign Het
Olfr1389 T A 11: 49,430,655 Y60N probably damaging Het
Olfr625-ps1 T A 7: 103,683,367 D206E probably damaging Het
Olfr668 T A 7: 104,925,735 T10S probably benign Het
Pcdha11 C T 18: 37,011,027 T57M probably benign Het
Pkp1 A T 1: 135,880,855 I458N possibly damaging Het
Prr12 T A 7: 45,051,229 probably benign Het
Prrc2c A T 1: 162,705,310 probably benign Het
Psd4 T C 2: 24,397,247 F397S probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rfx1 T A 8: 84,080,114 probably null Het
Rsl1 A G 13: 67,182,249 T254A possibly damaging Het
Sh3rf3 A G 10: 59,086,824 Q574R probably benign Het
Spire1 T C 18: 67,552,779 probably null Het
St6galnac4 G A 2: 32,594,063 G91D probably damaging Het
Sytl2 T C 7: 90,382,257 probably benign Het
Tbpl2 T A 2: 24,093,860 K188N possibly damaging Het
Tenm3 A T 8: 48,229,137 M2486K possibly damaging Het
Tgoln1 A C 6: 72,616,140 V119G possibly damaging Het
Tpgs1 A T 10: 79,669,491 N28Y probably benign Het
U2surp A C 9: 95,462,794 probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Vmn2r19 A G 6: 123,329,910 N459S probably benign Het
Vmn2r72 T C 7: 85,738,485 S624G probably damaging Het
Vps13c A G 9: 67,919,321 T1415A probably benign Het
Vwa5b1 G A 4: 138,608,843 P147S probably damaging Het
Other mutations in Olfr1507
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01336:Olfr1507 APN 14 52490748 missense probably damaging 1.00
IGL01367:Olfr1507 APN 14 52490167 missense probably benign 0.42
IGL01664:Olfr1507 APN 14 52490545 missense probably benign 0.01
IGL02890:Olfr1507 APN 14 52490911 missense probably benign
IGL03108:Olfr1507 APN 14 52490076 missense probably damaging 0.97
IGL03184:Olfr1507 APN 14 52490923 missense probably benign 0.20
R0563:Olfr1507 UTSW 14 52490257 nonsense probably null
R1080:Olfr1507 UTSW 14 52490585 nonsense probably null
R1558:Olfr1507 UTSW 14 52490146 missense probably benign 0.26
R1653:Olfr1507 UTSW 14 52490772 missense probably damaging 1.00
R1714:Olfr1507 UTSW 14 52490414 unclassified probably null
R1720:Olfr1507 UTSW 14 52490594 nonsense probably null
R3430:Olfr1507 UTSW 14 52490425 missense possibly damaging 0.92
R5954:Olfr1507 UTSW 14 52490167 missense probably benign 0.42
R6183:Olfr1507 UTSW 14 52490731 missense probably benign 0.05
R6518:Olfr1507 UTSW 14 52490620 missense probably damaging 1.00
R6651:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R6652:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R6653:Olfr1507 UTSW 14 52490793 missense probably benign 0.07
R7385:Olfr1507 UTSW 14 52490181 missense probably damaging 1.00
R7524:Olfr1507 UTSW 14 52490293 missense probably damaging 1.00
X0025:Olfr1507 UTSW 14 52490466 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCATAGAGATCATCCCACTGTTG -3'
(R):5'- CACTGTCACTGTCCCAAAGATG -3'

Sequencing Primer
(F):5'- TGGAGACAACGAGAATCTCAGTG -3'
(R):5'- GTCACTGTCCCAAAGATGCTAAGTG -3'
Posted On2016-05-10