Incidental Mutation 'R4995:C7'
ID385207
Institutional Source Beutler Lab
Gene Symbol C7
Ensembl Gene ENSMUSG00000079105
Gene Namecomplement component 7
SynonymsLOC383055
MMRRC Submission 042589-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4995 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location4988762-5063740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5049592 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 78 (G78D)
Ref Sequence ENSEMBL: ENSMUSP00000106317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110689]
Predicted Effect probably damaging
Transcript: ENSMUST00000110689
AA Change: G78D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106317
Gene: ENSMUSG00000079105
AA Change: G78D

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
TSP1 30 80 1.95e-7 SMART
LDLa 84 121 6.53e-9 SMART
MACPF 248 450 9.45e-51 SMART
TSP1 503 551 1.62e-4 SMART
CCP 571 626 1.84e-9 SMART
CCP 631 688 2.23e-8 SMART
FIMAC 699 766 1.63e-24 SMART
FIMAC 773 841 4.65e-20 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serum glycoprotein that forms a membrane attack complex together with complement components C5b, C6, C8, and C9 as part of the terminal complement pathway of the innate immune system. The protein encoded by this gene contains a cholesterol-dependent cytolysin/membrane attack complex/perforin-like (CDC/MACPF) domain and belongs to a large family of structurally related molecules that form pores involved in host immunity and bacterial pathogenesis. This protein initiates membrane attack complex formation by binding the C5b-C6 subcomplex and inserts into the phospholipid bilayer, serving as a membrane anchor. Mutations in this gene are associated with a rare disorder called C7 deficiency. [provided by RefSeq, Nov 2016]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,494,184 Q333* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acvrl1 G A 15: 101,135,860 R141H probably benign Het
Adprm A G 11: 67,041,610 F158L possibly damaging Het
Aldoart2 C T 12: 55,566,253 T321M probably benign Het
Ap3m2 A G 8: 22,803,776 V86A probably benign Het
Arhgef19 T A 4: 141,247,515 probably null Het
Armc4 G A 18: 7,223,663 T460M probably damaging Het
Bcl2l12 T G 7: 44,994,191 probably null Het
Bptf T C 11: 107,054,565 Q2501R probably damaging Het
C230029F24Rik A T 1: 49,338,136 noncoding transcript Het
Caly T C 7: 140,070,625 T135A probably benign Het
Cbl A G 9: 44,153,811 M740T possibly damaging Het
Cbx4 A G 11: 119,081,211 V446A probably benign Het
Celsr1 C A 15: 85,937,911 R1735L probably damaging Het
Cep250 A G 2: 155,988,316 D135G probably damaging Het
Cgn T C 3: 94,779,936 T19A probably damaging Het
Chic2 A T 5: 75,044,204 V32D probably damaging Het
Cntln A G 4: 85,049,883 K780E probably benign Het
Col8a2 A T 4: 126,310,788 D197V probably damaging Het
Crot A T 5: 8,974,000 V372E probably damaging Het
Cyb561d2 C T 9: 107,541,548 V26M probably damaging Het
Ddx5 G A 11: 106,785,236 T237I probably damaging Het
Dmxl2 G T 9: 54,501,441 probably benign Het
Dock8 T A 19: 25,158,383 S1188R probably benign Het
Ehbp1 T A 11: 22,101,073 H493L probably damaging Het
Eif5b T A 1: 38,051,711 *1217K probably null Het
Eprs A G 1: 185,410,139 probably benign Het
Etfdh T C 3: 79,605,788 D376G probably benign Het
Fam186a T C 15: 99,945,099 Q1088R probably benign Het
Fbxw16 G T 9: 109,441,250 T141N probably damaging Het
Fgf11 G A 11: 69,798,759 H138Y probably damaging Het
Gm1673 G A 5: 33,984,926 R79H probably damaging Het
Htra3 T C 5: 35,671,074 E154G probably damaging Het
Hydin T A 8: 110,569,642 V3601D probably damaging Het
Jup G T 11: 100,379,541 S380* probably null Het
Klrg1 T A 6: 122,278,275 D66V probably benign Het
Llgl1 C T 11: 60,709,724 A633V probably benign Het
Lmln T A 16: 33,074,097 Y203* probably null Het
Lrrc58 T G 16: 37,877,056 C165G probably benign Het
Lss T C 10: 76,547,537 V557A probably benign Het
Mast4 T C 13: 102,905,754 probably benign Het
Med13l C A 5: 118,730,949 P754Q possibly damaging Het
Mga C T 2: 119,932,582 R1240* probably null Het
Mgat5b T A 11: 116,974,199 probably null Het
Mtor A G 4: 148,525,752 D1572G probably damaging Het
Muc4 T A 16: 32,754,214 S1363T probably benign Het
Muc4 T A 16: 32,754,041 S1306T probably benign Het
Myo18b A G 5: 112,760,392 V2005A probably damaging Het
Myo1e G A 9: 70,353,272 D571N probably benign Het
Mypn T C 10: 63,119,968 probably null Het
Ndufb10 T C 17: 24,722,757 probably null Het
Nelfb G T 2: 25,206,196 D300E probably benign Het
Olfr1389 T A 11: 49,430,655 Y60N probably damaging Het
Olfr1507 A T 14: 52,490,531 C61* probably null Het
Olfr625-ps1 T A 7: 103,683,367 D206E probably damaging Het
Olfr668 T A 7: 104,925,735 T10S probably benign Het
Pcdha11 C T 18: 37,011,027 T57M probably benign Het
Pkp1 A T 1: 135,880,855 I458N possibly damaging Het
Prr12 T A 7: 45,051,229 probably benign Het
Prrc2c A T 1: 162,705,310 probably benign Het
Psd4 T C 2: 24,397,247 F397S probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rfx1 T A 8: 84,080,114 probably null Het
Rsl1 A G 13: 67,182,249 T254A possibly damaging Het
Sh3rf3 A G 10: 59,086,824 Q574R probably benign Het
Spire1 T C 18: 67,552,779 probably null Het
St6galnac4 G A 2: 32,594,063 G91D probably damaging Het
Sytl2 T C 7: 90,382,257 probably benign Het
Tbpl2 T A 2: 24,093,860 K188N possibly damaging Het
Tenm3 A T 8: 48,229,137 M2486K possibly damaging Het
Tgoln1 A C 6: 72,616,140 V119G possibly damaging Het
Tpgs1 A T 10: 79,669,491 N28Y probably benign Het
U2surp A C 9: 95,462,794 probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Vmn2r19 A G 6: 123,329,910 N459S probably benign Het
Vmn2r72 T C 7: 85,738,485 S624G probably damaging Het
Vps13c A G 9: 67,919,321 T1415A probably benign Het
Vwa5b1 G A 4: 138,608,843 P147S probably damaging Het
Other mutations in C7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02458:C7 APN 15 5059389 splice site probably benign
IGL02803:C7 APN 15 5049560 missense probably damaging 1.00
R0016:C7 UTSW 15 5046924 missense probably benign 0.01
R0016:C7 UTSW 15 5046924 missense probably benign 0.01
R0271:C7 UTSW 15 5015380 missense possibly damaging 0.81
R0360:C7 UTSW 15 4988962 missense probably benign 0.00
R0433:C7 UTSW 15 4988916 missense probably damaging 1.00
R0505:C7 UTSW 15 4994142 splice site probably benign
R1056:C7 UTSW 15 5045778 missense possibly damaging 0.89
R1443:C7 UTSW 15 5059419 missense probably benign 0.01
R1468:C7 UTSW 15 5012149 missense probably damaging 1.00
R1468:C7 UTSW 15 5012149 missense probably damaging 1.00
R1700:C7 UTSW 15 5002792 nonsense probably null
R1774:C7 UTSW 15 5012075 missense probably damaging 0.99
R1801:C7 UTSW 15 5012021 missense possibly damaging 0.61
R1809:C7 UTSW 15 5034339 missense probably damaging 0.99
R1986:C7 UTSW 15 5012012 missense possibly damaging 0.94
R2037:C7 UTSW 15 5034238 nonsense probably null
R2047:C7 UTSW 15 5045661 missense probably damaging 1.00
R2073:C7 UTSW 15 4990428 missense probably benign 0.09
R3972:C7 UTSW 15 5007651 missense possibly damaging 0.77
R4080:C7 UTSW 15 4990464 missense probably benign 0.09
R4200:C7 UTSW 15 4990309 critical splice donor site probably null
R4576:C7 UTSW 15 5002756 missense probably damaging 1.00
R4815:C7 UTSW 15 5059405 missense probably benign 0.16
R5300:C7 UTSW 15 5031950 missense probably damaging 1.00
R5562:C7 UTSW 15 5031915 nonsense probably null
R5708:C7 UTSW 15 5015401 missense possibly damaging 0.90
R5740:C7 UTSW 15 5057040 missense probably benign 0.00
R5873:C7 UTSW 15 5005235 missense probably damaging 1.00
R6222:C7 UTSW 15 5011941 missense possibly damaging 0.89
R6516:C7 UTSW 15 5057081 missense probably damaging 0.98
R6810:C7 UTSW 15 5007654 missense probably damaging 0.98
R7019:C7 UTSW 15 5045682 missense probably benign 0.04
R7199:C7 UTSW 15 4994243 missense probably benign 0.09
R7276:C7 UTSW 15 5011967 missense probably damaging 1.00
R7422:C7 UTSW 15 5012056 missense probably benign 0.13
R7652:C7 UTSW 15 5012105 missense probably damaging 1.00
R7783:C7 UTSW 15 5007710 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AATGGACGGTATCTACTATGTGG -3'
(R):5'- GAACATGTTCTCGGAAAGTGC -3'

Sequencing Primer
(F):5'- GGACGGTATCTACTATGTGGTTTATC -3'
(R):5'- ACATGTTCTCGGAAAGTGCTTTTTAG -3'
Posted On2016-05-10