Incidental Mutation 'R4995:Celsr1'
ID 385208
Institutional Source Beutler Lab
Gene Symbol Celsr1
Ensembl Gene ENSMUSG00000016028
Gene Name cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms Scy, Adgrc1, Crsh, crash
MMRRC Submission 042589-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.625) question?
Stock # R4995 (G1)
Quality Score 195
Status Validated
Chromosome 15
Chromosomal Location 85783130-85918404 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 85822112 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 1735 (R1735L)
Ref Sequence ENSEMBL: ENSMUSP00000016172 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016172]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000016172
AA Change: R1735L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016172
Gene: ENSMUSG00000016028
AA Change: R1735L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
low complexity region 65 93 N/A INTRINSIC
low complexity region 221 240 N/A INTRINSIC
low complexity region 243 257 N/A INTRINSIC
CA 282 366 9.51e-26 SMART
CA 390 472 1.59e-27 SMART
CA 496 578 3.8e-25 SMART
CA 602 700 2.25e-27 SMART
CA 724 802 3.14e-17 SMART
CA 826 905 2.67e-29 SMART
CA 929 1012 3.23e-28 SMART
CA 1036 1114 4.17e-22 SMART
CA 1142 1218 6.89e-1 SMART
EGF 1321 1376 3.38e-3 SMART
EGF 1381 1414 5.49e-3 SMART
EGF 1421 1456 9.7e-4 SMART
LamG 1477 1644 2.53e-33 SMART
EGF 1667 1700 6.4e-4 SMART
LamG 1726 1864 1.13e-21 SMART
EGF 1890 1923 1.84e-4 SMART
EGF 1925 1961 5.49e-3 SMART
EGF_Lam 2018 2063 7.12e-11 SMART
HormR 2066 2128 2.55e-20 SMART
Pfam:GAIN 2140 2396 1.1e-64 PFAM
GPS 2422 2475 5.03e-22 SMART
Pfam:7tm_2 2480 2712 2.6e-60 PFAM
low complexity region 2738 2753 N/A INTRINSIC
low complexity region 2819 2852 N/A INTRINSIC
low complexity region 2976 2988 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000226840
AA Change: R368L
Meta Mutation Damage Score 0.9219 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. This particular member is a developmentally regulated, neural-specific gene which plays an unspecified role in early embryogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit kinky tails, variable neural tube defects, abnormal hair follicle orientation, whorl-like hair patterns, and partial prenatal lethality. ENU-induced mutants show defects in planar polarity of inner ear hair cells and complete perinatal lethality due to craniorachischisis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,498,995 (GRCm39) Q333* probably null Het
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Acvrl1 G A 15: 101,033,741 (GRCm39) R141H probably benign Het
Adprm A G 11: 66,932,436 (GRCm39) F158L possibly damaging Het
Aldoart2 C T 12: 55,613,038 (GRCm39) T321M probably benign Het
Ap3m2 A G 8: 23,293,792 (GRCm39) V86A probably benign Het
Arhgef19 T A 4: 140,974,826 (GRCm39) probably null Het
Bcl2l12 T G 7: 44,643,615 (GRCm39) probably null Het
Bptf T C 11: 106,945,391 (GRCm39) Q2501R probably damaging Het
C230029F24Rik A T 1: 49,377,295 (GRCm39) noncoding transcript Het
C7 C T 15: 5,079,074 (GRCm39) G78D probably damaging Het
Caly T C 7: 139,650,538 (GRCm39) T135A probably benign Het
Cbl A G 9: 44,065,108 (GRCm39) M740T possibly damaging Het
Cbx4 A G 11: 118,972,037 (GRCm39) V446A probably benign Het
Cep250 A G 2: 155,830,236 (GRCm39) D135G probably damaging Het
Cgn T C 3: 94,687,246 (GRCm39) T19A probably damaging Het
Chic2 A T 5: 75,204,865 (GRCm39) V32D probably damaging Het
Cntln A G 4: 84,968,120 (GRCm39) K780E probably benign Het
Col8a2 A T 4: 126,204,581 (GRCm39) D197V probably damaging Het
Crot A T 5: 9,024,000 (GRCm39) V372E probably damaging Het
Cyb561d2 C T 9: 107,418,747 (GRCm39) V26M probably damaging Het
Ddx5 G A 11: 106,676,062 (GRCm39) T237I probably damaging Het
Dmxl2 G T 9: 54,408,725 (GRCm39) probably benign Het
Dock8 T A 19: 25,135,747 (GRCm39) S1188R probably benign Het
Ehbp1 T A 11: 22,051,073 (GRCm39) H493L probably damaging Het
Eif5b T A 1: 38,090,792 (GRCm39) *1217K probably null Het
Eprs1 A G 1: 185,142,336 (GRCm39) probably benign Het
Etfdh T C 3: 79,513,095 (GRCm39) D376G probably benign Het
Fam186a T C 15: 99,842,980 (GRCm39) Q1088R probably benign Het
Fbxw16 G T 9: 109,270,318 (GRCm39) T141N probably damaging Het
Fgf11 G A 11: 69,689,585 (GRCm39) H138Y probably damaging Het
Htra3 T C 5: 35,828,418 (GRCm39) E154G probably damaging Het
Hydin T A 8: 111,296,274 (GRCm39) V3601D probably damaging Het
Jup G T 11: 100,270,367 (GRCm39) S380* probably null Het
Klrg1 T A 6: 122,255,234 (GRCm39) D66V probably benign Het
Llgl1 C T 11: 60,600,550 (GRCm39) A633V probably benign Het
Lmln T A 16: 32,894,467 (GRCm39) Y203* probably null Het
Lrrc58 T G 16: 37,697,418 (GRCm39) C165G probably benign Het
Lss T C 10: 76,383,371 (GRCm39) V557A probably benign Het
Mast4 T C 13: 103,042,262 (GRCm39) probably benign Het
Med13l C A 5: 118,869,014 (GRCm39) P754Q possibly damaging Het
Mga C T 2: 119,763,063 (GRCm39) R1240* probably null Het
Mgat5b T A 11: 116,865,025 (GRCm39) probably null Het
Mtor A G 4: 148,610,209 (GRCm39) D1572G probably damaging Het
Muc4 T A 16: 32,754,214 (GRCm38) S1363T probably benign Het
Muc4 T A 16: 32,575,332 (GRCm39) S1306T probably benign Het
Myo18b A G 5: 112,908,258 (GRCm39) V2005A probably damaging Het
Myo1e G A 9: 70,260,554 (GRCm39) D571N probably benign Het
Mypn T C 10: 62,955,747 (GRCm39) probably null Het
Ndufb10 T C 17: 24,941,731 (GRCm39) probably null Het
Nelfb G T 2: 25,096,208 (GRCm39) D300E probably benign Het
Nicol1 G A 5: 34,142,270 (GRCm39) R79H probably damaging Het
Odad2 G A 18: 7,223,663 (GRCm39) T460M probably damaging Het
Or2y1d T A 11: 49,321,482 (GRCm39) Y60N probably damaging Het
Or4e5 A T 14: 52,727,988 (GRCm39) C61* probably null Het
Or52n2c T A 7: 104,574,942 (GRCm39) T10S probably benign Het
Or52z15 T A 7: 103,332,574 (GRCm39) D206E probably damaging Het
Pcdha11 C T 18: 37,144,080 (GRCm39) T57M probably benign Het
Pkp1 A T 1: 135,808,593 (GRCm39) I458N possibly damaging Het
Prr12 T A 7: 44,700,653 (GRCm39) probably benign Het
Prrc2c A T 1: 162,532,879 (GRCm39) probably benign Het
Psd4 T C 2: 24,287,259 (GRCm39) F397S probably benign Het
Pygm T C 19: 6,448,169 (GRCm39) I737T probably damaging Het
Rfx1 T A 8: 84,806,743 (GRCm39) probably null Het
Rsl1 A G 13: 67,330,313 (GRCm39) T254A possibly damaging Het
Sh3rf3 A G 10: 58,922,646 (GRCm39) Q574R probably benign Het
Spire1 T C 18: 67,685,849 (GRCm39) probably null Het
St6galnac4 G A 2: 32,484,075 (GRCm39) G91D probably damaging Het
Sytl2 T C 7: 90,031,465 (GRCm39) probably benign Het
Tbpl2 T A 2: 23,983,872 (GRCm39) K188N possibly damaging Het
Tenm3 A T 8: 48,682,172 (GRCm39) M2486K possibly damaging Het
Tgoln1 A C 6: 72,593,123 (GRCm39) V119G possibly damaging Het
Tpgs1 A T 10: 79,505,325 (GRCm39) N28Y probably benign Het
U2surp A C 9: 95,344,847 (GRCm39) probably benign Het
Vmn2r103 A G 17: 19,993,773 (GRCm39) H50R probably benign Het
Vmn2r19 A G 6: 123,306,869 (GRCm39) N459S probably benign Het
Vmn2r72 T C 7: 85,387,693 (GRCm39) S624G probably damaging Het
Vps13c A G 9: 67,826,603 (GRCm39) T1415A probably benign Het
Vwa5b1 G A 4: 138,336,154 (GRCm39) P147S probably damaging Het
Other mutations in Celsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Celsr1 APN 15 85,815,546 (GRCm39) missense probably benign 0.04
IGL00519:Celsr1 APN 15 85,915,037 (GRCm39) missense probably damaging 1.00
IGL00909:Celsr1 APN 15 85,806,436 (GRCm39) missense probably damaging 1.00
IGL01303:Celsr1 APN 15 85,914,692 (GRCm39) missense probably damaging 0.97
IGL01726:Celsr1 APN 15 85,810,391 (GRCm39) missense probably benign 0.35
IGL01910:Celsr1 APN 15 85,814,096 (GRCm39) missense probably benign
IGL01931:Celsr1 APN 15 85,791,861 (GRCm39) missense probably damaging 1.00
IGL01952:Celsr1 APN 15 85,847,424 (GRCm39) missense probably benign 0.35
IGL02090:Celsr1 APN 15 85,791,922 (GRCm39) missense possibly damaging 0.49
IGL02191:Celsr1 APN 15 85,863,205 (GRCm39) missense possibly damaging 0.69
IGL02372:Celsr1 APN 15 85,814,108 (GRCm39) missense probably benign 0.01
IGL02413:Celsr1 APN 15 85,915,427 (GRCm39) missense possibly damaging 0.96
IGL02478:Celsr1 APN 15 85,825,337 (GRCm39) missense possibly damaging 0.68
IGL02507:Celsr1 APN 15 85,784,889 (GRCm39) utr 3 prime probably benign
IGL02508:Celsr1 APN 15 85,914,818 (GRCm39) nonsense probably null
IGL02899:Celsr1 APN 15 85,915,927 (GRCm39) missense probably damaging 0.98
IGL02939:Celsr1 APN 15 85,785,673 (GRCm39) missense probably benign
IGL03212:Celsr1 APN 15 85,814,878 (GRCm39) missense probably benign 0.04
P0028:Celsr1 UTSW 15 85,806,436 (GRCm39) missense probably damaging 1.00
PIT4305001:Celsr1 UTSW 15 85,785,138 (GRCm39) missense possibly damaging 0.87
PIT4480001:Celsr1 UTSW 15 85,916,615 (GRCm39) missense probably damaging 0.99
R0018:Celsr1 UTSW 15 85,915,243 (GRCm39) missense possibly damaging 0.47
R0018:Celsr1 UTSW 15 85,915,243 (GRCm39) missense possibly damaging 0.47
R0038:Celsr1 UTSW 15 85,813,620 (GRCm39) missense possibly damaging 0.65
R0057:Celsr1 UTSW 15 85,914,963 (GRCm39) missense probably benign 0.02
R0060:Celsr1 UTSW 15 85,806,399 (GRCm39) missense probably damaging 0.98
R0060:Celsr1 UTSW 15 85,806,399 (GRCm39) missense probably damaging 0.98
R0279:Celsr1 UTSW 15 85,787,065 (GRCm39) missense probably benign 0.00
R0570:Celsr1 UTSW 15 85,787,566 (GRCm39) missense probably benign 0.18
R0611:Celsr1 UTSW 15 85,816,524 (GRCm39) missense possibly damaging 0.91
R0731:Celsr1 UTSW 15 85,785,798 (GRCm39) missense probably benign
R0792:Celsr1 UTSW 15 85,815,477 (GRCm39) missense probably benign 0.02
R0943:Celsr1 UTSW 15 85,787,489 (GRCm39) missense probably damaging 1.00
R0989:Celsr1 UTSW 15 85,915,480 (GRCm39) missense probably benign 0.39
R1118:Celsr1 UTSW 15 85,916,248 (GRCm39) missense probably damaging 1.00
R1237:Celsr1 UTSW 15 85,788,175 (GRCm39) missense probably benign 0.01
R1239:Celsr1 UTSW 15 85,863,347 (GRCm39) missense probably damaging 0.99
R1405:Celsr1 UTSW 15 85,789,635 (GRCm39) splice site probably null
R1405:Celsr1 UTSW 15 85,789,635 (GRCm39) splice site probably null
R1522:Celsr1 UTSW 15 85,815,477 (GRCm39) missense probably benign 0.02
R1662:Celsr1 UTSW 15 85,915,263 (GRCm39) missense probably damaging 1.00
R1673:Celsr1 UTSW 15 85,816,658 (GRCm39) missense probably benign 0.00
R1795:Celsr1 UTSW 15 85,914,524 (GRCm39) missense probably damaging 0.99
R1799:Celsr1 UTSW 15 85,916,886 (GRCm39) missense probably damaging 1.00
R1858:Celsr1 UTSW 15 85,916,960 (GRCm39) missense probably damaging 1.00
R2040:Celsr1 UTSW 15 85,917,088 (GRCm39) missense probably damaging 1.00
R2050:Celsr1 UTSW 15 85,914,748 (GRCm39) missense probably benign 0.02
R2131:Celsr1 UTSW 15 85,847,424 (GRCm39) missense probably benign 0.35
R2132:Celsr1 UTSW 15 85,916,168 (GRCm39) missense possibly damaging 0.91
R2189:Celsr1 UTSW 15 85,863,431 (GRCm39) missense possibly damaging 0.93
R2192:Celsr1 UTSW 15 85,800,924 (GRCm39) missense possibly damaging 0.93
R4213:Celsr1 UTSW 15 85,916,008 (GRCm39) missense probably damaging 1.00
R4356:Celsr1 UTSW 15 85,863,028 (GRCm39) missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85,812,200 (GRCm39) missense probably damaging 1.00
R4414:Celsr1 UTSW 15 85,847,334 (GRCm39) missense probably benign 0.00
R4416:Celsr1 UTSW 15 85,812,200 (GRCm39) missense probably damaging 1.00
R4645:Celsr1 UTSW 15 85,800,957 (GRCm39) missense probably benign 0.35
R4666:Celsr1 UTSW 15 85,914,695 (GRCm39) missense probably damaging 1.00
R4687:Celsr1 UTSW 15 85,816,661 (GRCm39) missense possibly damaging 0.94
R4735:Celsr1 UTSW 15 85,790,230 (GRCm39) critical splice acceptor site probably null
R4804:Celsr1 UTSW 15 85,822,154 (GRCm39) missense possibly damaging 0.49
R5070:Celsr1 UTSW 15 85,823,335 (GRCm39) missense possibly damaging 0.89
R5218:Celsr1 UTSW 15 85,816,585 (GRCm39) missense probably damaging 1.00
R5280:Celsr1 UTSW 15 85,814,747 (GRCm39) missense probably benign
R5310:Celsr1 UTSW 15 85,810,423 (GRCm39) missense possibly damaging 0.88
R5388:Celsr1 UTSW 15 85,809,719 (GRCm39) missense probably damaging 0.99
R5484:Celsr1 UTSW 15 85,815,483 (GRCm39) missense probably benign 0.00
R5639:Celsr1 UTSW 15 85,914,968 (GRCm39) missense probably damaging 1.00
R5758:Celsr1 UTSW 15 85,825,465 (GRCm39) missense probably benign 0.27
R5778:Celsr1 UTSW 15 85,917,156 (GRCm39) missense probably damaging 1.00
R5893:Celsr1 UTSW 15 85,788,215 (GRCm39) missense probably benign 0.02
R5915:Celsr1 UTSW 15 85,914,550 (GRCm39) missense probably damaging 0.96
R5915:Celsr1 UTSW 15 85,822,176 (GRCm39) missense probably benign
R5932:Celsr1 UTSW 15 85,916,905 (GRCm39) missense probably damaging 1.00
R5950:Celsr1 UTSW 15 85,916,701 (GRCm39) missense probably damaging 1.00
R5975:Celsr1 UTSW 15 85,803,239 (GRCm39) splice site probably null
R6050:Celsr1 UTSW 15 85,814,812 (GRCm39) missense probably benign 0.00
R6117:Celsr1 UTSW 15 85,816,612 (GRCm39) missense probably benign 0.04
R6178:Celsr1 UTSW 15 85,785,222 (GRCm39) missense probably benign 0.08
R6186:Celsr1 UTSW 15 85,805,394 (GRCm39) missense possibly damaging 0.84
R6212:Celsr1 UTSW 15 85,800,888 (GRCm39) missense probably benign 0.25
R6307:Celsr1 UTSW 15 85,812,531 (GRCm39) missense probably benign
R6320:Celsr1 UTSW 15 85,785,160 (GRCm39) missense probably benign 0.13
R6349:Celsr1 UTSW 15 85,915,885 (GRCm39) missense probably damaging 1.00
R6478:Celsr1 UTSW 15 85,809,719 (GRCm39) missense probably damaging 0.99
R6504:Celsr1 UTSW 15 85,863,121 (GRCm39) missense probably benign 0.07
R6607:Celsr1 UTSW 15 85,847,486 (GRCm39) missense probably benign
R6615:Celsr1 UTSW 15 85,786,315 (GRCm39) critical splice donor site probably null
R6661:Celsr1 UTSW 15 85,803,135 (GRCm39) missense probably damaging 1.00
R6722:Celsr1 UTSW 15 85,790,115 (GRCm39) critical splice donor site probably null
R6743:Celsr1 UTSW 15 85,791,799 (GRCm39) missense probably damaging 0.96
R6746:Celsr1 UTSW 15 85,915,696 (GRCm39) missense probably damaging 1.00
R6772:Celsr1 UTSW 15 85,914,983 (GRCm39) missense probably benign
R6838:Celsr1 UTSW 15 85,823,395 (GRCm39) missense probably benign
R6886:Celsr1 UTSW 15 85,915,855 (GRCm39) missense probably benign 0.00
R7030:Celsr1 UTSW 15 85,789,679 (GRCm39) missense probably damaging 0.99
R7060:Celsr1 UTSW 15 85,916,856 (GRCm39) missense probably benign 0.07
R7080:Celsr1 UTSW 15 85,816,652 (GRCm39) missense possibly damaging 0.87
R7325:Celsr1 UTSW 15 85,917,209 (GRCm39) missense probably damaging 0.99
R7357:Celsr1 UTSW 15 85,914,715 (GRCm39) missense probably benign 0.00
R7371:Celsr1 UTSW 15 85,914,875 (GRCm39) missense possibly damaging 0.91
R7446:Celsr1 UTSW 15 85,791,874 (GRCm39) missense possibly damaging 0.95
R7465:Celsr1 UTSW 15 85,917,593 (GRCm39) missense probably benign
R7491:Celsr1 UTSW 15 85,916,719 (GRCm39) missense possibly damaging 0.78
R7639:Celsr1 UTSW 15 85,814,073 (GRCm39) missense probably benign 0.00
R7685:Celsr1 UTSW 15 85,862,933 (GRCm39) nonsense probably null
R7741:Celsr1 UTSW 15 85,863,303 (GRCm39) missense possibly damaging 0.94
R7768:Celsr1 UTSW 15 85,816,610 (GRCm39) missense probably benign
R7974:Celsr1 UTSW 15 85,915,231 (GRCm39) missense probably damaging 1.00
R7977:Celsr1 UTSW 15 85,917,194 (GRCm39) missense probably damaging 1.00
R7987:Celsr1 UTSW 15 85,917,194 (GRCm39) missense probably damaging 1.00
R8073:Celsr1 UTSW 15 85,823,356 (GRCm39) missense probably benign 0.00
R8099:Celsr1 UTSW 15 85,915,801 (GRCm39) missense probably damaging 0.99
R8190:Celsr1 UTSW 15 85,787,090 (GRCm39) missense probably damaging 0.99
R8210:Celsr1 UTSW 15 85,863,436 (GRCm39) missense probably benign 0.00
R8289:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8290:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8292:Celsr1 UTSW 15 85,791,819 (GRCm39) missense possibly damaging 0.90
R8328:Celsr1 UTSW 15 85,806,445 (GRCm39) missense probably benign 0.00
R8330:Celsr1 UTSW 15 85,816,501 (GRCm39) missense probably damaging 0.99
R8333:Celsr1 UTSW 15 85,915,615 (GRCm39) missense possibly damaging 0.65
R8352:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8384:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8452:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8463:Celsr1 UTSW 15 85,914,415 (GRCm39) missense probably damaging 1.00
R8479:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8480:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8493:Celsr1 UTSW 15 85,822,207 (GRCm39) missense possibly damaging 0.67
R8498:Celsr1 UTSW 15 85,823,306 (GRCm39) missense probably benign 0.01
R8506:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R8771:Celsr1 UTSW 15 85,788,175 (GRCm39) missense probably benign 0.01
R8891:Celsr1 UTSW 15 85,822,194 (GRCm39) missense probably benign 0.01
R8905:Celsr1 UTSW 15 85,788,269 (GRCm39) intron probably benign
R8924:Celsr1 UTSW 15 85,916,671 (GRCm39) missense possibly damaging 0.94
R8979:Celsr1 UTSW 15 85,847,340 (GRCm39) missense probably damaging 0.96
R9069:Celsr1 UTSW 15 85,914,772 (GRCm39) missense possibly damaging 0.53
R9115:Celsr1 UTSW 15 85,803,217 (GRCm39) missense probably damaging 1.00
R9194:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9196:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9198:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9200:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9201:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9202:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9203:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9222:Celsr1 UTSW 15 85,815,471 (GRCm39) missense possibly damaging 0.68
R9236:Celsr1 UTSW 15 85,915,051 (GRCm39) missense probably damaging 1.00
R9384:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9386:Celsr1 UTSW 15 85,863,231 (GRCm39) missense probably damaging 1.00
R9400:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9401:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9415:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9428:Celsr1 UTSW 15 85,815,549 (GRCm39) missense possibly damaging 0.64
R9435:Celsr1 UTSW 15 85,806,535 (GRCm39) splice site probably benign
R9493:Celsr1 UTSW 15 85,785,346 (GRCm39) missense probably damaging 0.98
R9495:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9499:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
R9607:Celsr1 UTSW 15 85,915,229 (GRCm39) missense
R9673:Celsr1 UTSW 15 85,917,286 (GRCm39) nonsense probably null
Z1176:Celsr1 UTSW 15 85,847,301 (GRCm39) missense probably damaging 0.96
Z1177:Celsr1 UTSW 15 85,863,052 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGTAGCGGATGCCCTTC -3'
(R):5'- AAGTCTGAAGCTAGCATGTGGG -3'

Sequencing Primer
(F):5'- ATGCCCTTCCCAGGCAG -3'
(R):5'- AAGAAGGGCTTCACCTGGCTG -3'
Posted On 2016-05-10