Incidental Mutation 'R4995:Ndufb10'
ID385216
Institutional Source Beutler Lab
Gene Symbol Ndufb10
Ensembl Gene ENSMUSG00000040048
Gene NameNADH dehydrogenase (ubiquinone) 1 beta subcomplex, 10
Synonyms22kDa, 0610011B04Rik
MMRRC Submission 042589-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R4995 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location24722060-24724478 bp(-) (GRCm38)
Type of Mutationunclassified (831 bp from exon)
DNA Base Change (assembly) T to C at 24722757 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008626] [ENSMUST00000045602] [ENSMUST00000054289] [ENSMUST00000135708] [ENSMUST00000146867] [ENSMUST00000152407] [ENSMUST00000170715]
Predicted Effect probably benign
Transcript: ENSMUST00000008626
SMART Domains Protein: ENSMUSP00000008626
Gene: ENSMUSG00000008482

DomainStartEndE-ValueType
RING 20 57 1.76e-5 SMART
Pfam:zf-TRAF 102 158 7.5e-9 PFAM
low complexity region 176 193 N/A INTRINSIC
low complexity region 203 216 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000045602
AA Change: Y62C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000043543
Gene: ENSMUSG00000040048
AA Change: Y62C

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 42 168 2.1e-52 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000054289
SMART Domains Protein: ENSMUSP00000092502
Gene: ENSMUSG00000044533

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 5.7e-34 PFAM
Pfam:Ribosomal_S5_C 185 256 2.4e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104521
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122809
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132803
Predicted Effect probably damaging
Transcript: ENSMUST00000135708
AA Change: Y77C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120091
Gene: ENSMUSG00000040048
AA Change: Y77C

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:NDUFB10 54 149 7.1e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141324
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144285
Predicted Effect probably null
Transcript: ENSMUST00000146867
SMART Domains Protein: ENSMUSP00000120715
Gene: ENSMUSG00000044533

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 102 166 1.7e-35 PFAM
Pfam:Ribosomal_S5_C 185 256 8.3e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147648
Predicted Effect probably null
Transcript: ENSMUST00000152407
SMART Domains Protein: ENSMUSP00000114529
Gene: ENSMUSG00000044533

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 9.2e-32 PFAM
Pfam:Ribosomal_S5_C 184 257 1.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158630
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161706
Predicted Effect probably null
Transcript: ENSMUST00000170715
SMART Domains Protein: ENSMUSP00000131474
Gene: ENSMUSG00000044533

DomainStartEndE-ValueType
low complexity region 6 53 N/A INTRINSIC
Pfam:Ribosomal_S5 101 167 1.1e-31 PFAM
Pfam:Ribosomal_S5_C 184 257 1.3e-24 PFAM
Meta Mutation Damage Score 0.2357 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 99% (86/87)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921504E06Rik G A 2: 19,494,184 Q333* probably null Het
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Acvrl1 G A 15: 101,135,860 R141H probably benign Het
Adprm A G 11: 67,041,610 F158L possibly damaging Het
Aldoart2 C T 12: 55,566,253 T321M probably benign Het
Ap3m2 A G 8: 22,803,776 V86A probably benign Het
Arhgef19 T A 4: 141,247,515 probably null Het
Armc4 G A 18: 7,223,663 T460M probably damaging Het
Bcl2l12 T G 7: 44,994,191 probably null Het
Bptf T C 11: 107,054,565 Q2501R probably damaging Het
C230029F24Rik A T 1: 49,338,136 noncoding transcript Het
C7 C T 15: 5,049,592 G78D probably damaging Het
Caly T C 7: 140,070,625 T135A probably benign Het
Cbl A G 9: 44,153,811 M740T possibly damaging Het
Cbx4 A G 11: 119,081,211 V446A probably benign Het
Celsr1 C A 15: 85,937,911 R1735L probably damaging Het
Cep250 A G 2: 155,988,316 D135G probably damaging Het
Cgn T C 3: 94,779,936 T19A probably damaging Het
Chic2 A T 5: 75,044,204 V32D probably damaging Het
Cntln A G 4: 85,049,883 K780E probably benign Het
Col8a2 A T 4: 126,310,788 D197V probably damaging Het
Crot A T 5: 8,974,000 V372E probably damaging Het
Cyb561d2 C T 9: 107,541,548 V26M probably damaging Het
Ddx5 G A 11: 106,785,236 T237I probably damaging Het
Dmxl2 G T 9: 54,501,441 probably benign Het
Dock8 T A 19: 25,158,383 S1188R probably benign Het
Ehbp1 T A 11: 22,101,073 H493L probably damaging Het
Eif5b T A 1: 38,051,711 *1217K probably null Het
Eprs A G 1: 185,410,139 probably benign Het
Etfdh T C 3: 79,605,788 D376G probably benign Het
Fam186a T C 15: 99,945,099 Q1088R probably benign Het
Fbxw16 G T 9: 109,441,250 T141N probably damaging Het
Fgf11 G A 11: 69,798,759 H138Y probably damaging Het
Gm1673 G A 5: 33,984,926 R79H probably damaging Het
Htra3 T C 5: 35,671,074 E154G probably damaging Het
Hydin T A 8: 110,569,642 V3601D probably damaging Het
Jup G T 11: 100,379,541 S380* probably null Het
Klrg1 T A 6: 122,278,275 D66V probably benign Het
Llgl1 C T 11: 60,709,724 A633V probably benign Het
Lmln T A 16: 33,074,097 Y203* probably null Het
Lrrc58 T G 16: 37,877,056 C165G probably benign Het
Lss T C 10: 76,547,537 V557A probably benign Het
Mast4 T C 13: 102,905,754 probably benign Het
Med13l C A 5: 118,730,949 P754Q possibly damaging Het
Mga C T 2: 119,932,582 R1240* probably null Het
Mgat5b T A 11: 116,974,199 probably null Het
Mtor A G 4: 148,525,752 D1572G probably damaging Het
Muc4 T A 16: 32,754,214 S1363T probably benign Het
Muc4 T A 16: 32,754,041 S1306T probably benign Het
Myo18b A G 5: 112,760,392 V2005A probably damaging Het
Myo1e G A 9: 70,353,272 D571N probably benign Het
Mypn T C 10: 63,119,968 probably null Het
Nelfb G T 2: 25,206,196 D300E probably benign Het
Olfr1389 T A 11: 49,430,655 Y60N probably damaging Het
Olfr1507 A T 14: 52,490,531 C61* probably null Het
Olfr625-ps1 T A 7: 103,683,367 D206E probably damaging Het
Olfr668 T A 7: 104,925,735 T10S probably benign Het
Pcdha11 C T 18: 37,011,027 T57M probably benign Het
Pkp1 A T 1: 135,880,855 I458N possibly damaging Het
Prr12 T A 7: 45,051,229 probably benign Het
Prrc2c A T 1: 162,705,310 probably benign Het
Psd4 T C 2: 24,397,247 F397S probably benign Het
Pygm T C 19: 6,398,139 I737T probably damaging Het
Rfx1 T A 8: 84,080,114 probably null Het
Rsl1 A G 13: 67,182,249 T254A possibly damaging Het
Sh3rf3 A G 10: 59,086,824 Q574R probably benign Het
Spire1 T C 18: 67,552,779 probably null Het
St6galnac4 G A 2: 32,594,063 G91D probably damaging Het
Sytl2 T C 7: 90,382,257 probably benign Het
Tbpl2 T A 2: 24,093,860 K188N possibly damaging Het
Tenm3 A T 8: 48,229,137 M2486K possibly damaging Het
Tgoln1 A C 6: 72,616,140 V119G possibly damaging Het
Tpgs1 A T 10: 79,669,491 N28Y probably benign Het
U2surp A C 9: 95,462,794 probably benign Het
Vmn2r103 A G 17: 19,773,511 H50R probably benign Het
Vmn2r19 A G 6: 123,329,910 N459S probably benign Het
Vmn2r72 T C 7: 85,738,485 S624G probably damaging Het
Vps13c A G 9: 67,919,321 T1415A probably benign Het
Vwa5b1 G A 4: 138,608,843 P147S probably damaging Het
Other mutations in Ndufb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Ndufb10 APN 17 24724184 splice site probably null
R0157:Ndufb10 UTSW 17 24724244 missense probably benign 0.39
R0189:Ndufb10 UTSW 17 24724235 missense probably benign 0.16
R0834:Ndufb10 UTSW 17 24722674 missense probably damaging 1.00
R1164:Ndufb10 UTSW 17 24722783 missense probably benign 0.22
R2015:Ndufb10 UTSW 17 24722529 splice site probably null
R4687:Ndufb10 UTSW 17 24722419 missense possibly damaging 0.89
R5629:Ndufb10 UTSW 17 24722682 missense probably damaging 1.00
R7310:Ndufb10 UTSW 17 24722214 missense probably damaging 0.99
X0024:Ndufb10 UTSW 17 24722178 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGGGAATCAACATTTCAGGAG -3'
(R):5'- GGGTCTGTAAAAGCTTGGGAC -3'

Sequencing Primer
(F):5'- TCAACATTTCAGGAGAGATGGGGTTC -3'
(R):5'- ACTCTTTGAAGACCAGGCTG -3'
Posted On2016-05-10