Incidental Mutation 'R4996:Tenm3'
ID385259
Institutional Source Beutler Lab
Gene Symbol Tenm3
Ensembl Gene ENSMUSG00000031561
Gene Nameteneurin transmembrane protein 3
SynonymsTen-m3, Odz3, 2610100B16Rik
MMRRC Submission 042590-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.606) question?
Stock #R4996 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location48227682-48843951 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 48235826 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 2226 (I2226N)
Ref Sequence ENSEMBL: ENSMUSP00000140141 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033965] [ENSMUST00000190840]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033965
AA Change: I2242N

PolyPhen 2 Score 0.622 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033965
Gene: ENSMUSG00000031561
AA Change: I2242N

DomainStartEndE-ValueType
Pfam:Ten_N 11 177 6.9e-91 PFAM
Pfam:Ten_N 171 308 1e-72 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2631 2708 1.5e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000190840
AA Change: I2226N

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000140141
Gene: ENSMUSG00000031561
AA Change: I2226N

DomainStartEndE-ValueType
Pfam:Ten_N 10 182 7.6e-77 PFAM
Pfam:Ten_N 168 308 6.6e-50 PFAM
transmembrane domain 309 331 N/A INTRINSIC
EGF 517 545 2.32e-1 SMART
EGF_like 548 576 4.11e1 SMART
EGF 581 610 1.69e1 SMART
EGF 613 642 1.35e-2 SMART
EGF 647 677 6.11e-1 SMART
EGF 680 708 7.95e0 SMART
EGF 711 739 1.28e1 SMART
EGF 751 783 1.64e-1 SMART
PDB:1RWL|A 1276 1511 9e-6 PDB
low complexity region 2593 2602 N/A INTRINSIC
Pfam:Tox-GHH 2630 2708 3.2e-35 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large transmembrane protein that may be involved in the regulation of neuronal development. Mutation in this gene causes microphthalmia. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a null mutation display abnormal ipsilateral retinal ganglion cell projections and impaired performance in visually mediated behavioral tasks. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Actl11 A G 9: 107,931,735 I1086V possibly damaging Het
Adgrv1 T C 13: 81,578,734 S500G probably benign Het
Ahcyl1 A T 3: 107,668,287 V394E probably damaging Het
Alg9 T C 9: 50,808,705 F494L probably damaging Het
Ankrd55 C A 13: 112,356,088 D264E possibly damaging Het
Asb14 A G 14: 26,912,116 N426S possibly damaging Het
Atm A T 9: 53,524,507 F168I probably benign Het
Atp13a4 A T 16: 29,472,004 I209N probably damaging Het
BB014433 A T 8: 15,042,166 L229Q probably benign Het
C130026I21Rik G T 1: 85,247,094 A240E probably benign Het
Calml3 T C 13: 3,804,142 D21G probably damaging Het
Capn10 A G 1: 92,945,136 N528S probably damaging Het
Ccnl2 T A 4: 155,813,524 D141E possibly damaging Het
Cd163 A G 6: 124,319,147 I817V probably benign Het
Cgnl1 CTTGCCCAGGTT CTT 9: 71,724,826 probably benign Het
Cln6 T A 9: 62,850,655 I232N probably damaging Het
Col22a1 A C 15: 72,007,161 V49G probably damaging Het
Csmd1 A T 8: 15,910,452 M3321K probably damaging Het
Cyp2u1 T A 3: 131,298,284 M196L probably benign Het
Dlec1 T G 9: 119,146,050 L1566R probably damaging Het
Dnajc3 A G 14: 118,972,427 T305A probably benign Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Efhd1 G T 1: 87,264,558 G37W possibly damaging Het
Exph5 G C 9: 53,375,610 E1330D possibly damaging Het
Fam207a A T 10: 77,515,533 W14R probably null Het
Fbln2 A T 6: 91,266,010 Y913F probably benign Het
Fmnl1 G A 11: 103,182,656 S167N possibly damaging Het
Frs3 A G 17: 47,701,710 E114G probably damaging Het
Gm960 T A 19: 4,626,084 K673N probably benign Het
Gmpr2 T C 14: 55,676,795 I169T probably damaging Het
Gria2 A G 3: 80,707,141 S531P probably damaging Het
Hace1 G A 10: 45,649,950 A296T probably benign Het
Hrasls G A 16: 29,217,704 W31* probably null Het
Inhbb A C 1: 119,420,818 L90R probably damaging Het
Insr C T 8: 3,192,665 R18Q probably null Het
Kdm6b G T 11: 69,405,731 P570Q probably damaging Het
Lama3 T C 18: 12,518,743 V1803A probably benign Het
Lpin3 T A 2: 160,905,287 L811Q probably damaging Het
Lrrc8e C T 8: 4,235,166 L464F probably damaging Het
Micall2 A G 5: 139,710,589 S729P probably benign Het
Naca C T 10: 128,042,429 probably benign Het
Nav1 A T 1: 135,465,971 S1010T probably damaging Het
Nefm T C 14: 68,121,121 probably benign Het
Nlrp9c A T 7: 26,385,747 F136I possibly damaging Het
Nup210 A T 6: 91,053,436 F137Y probably benign Het
Olfr1079 T C 2: 86,538,271 I215V probably benign Het
Olfr402 A G 11: 74,155,331 H59R probably damaging Het
Olfr98 A G 17: 37,262,867 S266P probably benign Het
Otog C A 7: 46,298,606 H2344N possibly damaging Het
Otog C A 7: 46,305,510 C517* probably null Het
Pcdhac1 C T 18: 37,092,527 Q798* probably null Het
Pdhx T C 2: 103,030,312 D330G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Pgr C A 9: 8,900,913 P149Q probably damaging Het
Ppm1h A T 10: 122,941,340 I504F probably damaging Het
Ppp6r3 A G 19: 3,473,833 S556P probably damaging Het
Ranbp9 G A 13: 43,425,094 Q168* probably null Het
Relb A T 7: 19,615,603 L259Q probably benign Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Rgcc T C 14: 79,290,276 D125G possibly damaging Het
Rmnd5b A G 11: 51,627,908 V86A probably damaging Het
Slc15a5 G A 6: 138,043,585 T250M probably damaging Het
Slc7a2 A T 8: 40,912,562 K477* probably null Het
Smc2 T A 4: 52,461,042 probably null Het
Sox5 A T 6: 144,028,344 L226* probably null Het
Syne2 A G 12: 75,943,950 E1903G possibly damaging Het
Tmtc3 A T 10: 100,447,224 I823N probably damaging Het
Tor3a T C 1: 156,655,772 Y360C probably damaging Het
Trpc3 T C 3: 36,662,818 E357G probably benign Het
Ttc30a1 C T 2: 75,979,922 G606S probably benign Het
Tubgcp6 A T 15: 89,103,490 N1093K possibly damaging Het
Vmn1r64 T A 7: 5,884,053 T164S probably benign Het
Vmn2r40 T A 7: 8,908,167 Q709L probably damaging Het
Vmn2r81 A T 10: 79,293,413 I713L probably benign Het
Washc5 T C 15: 59,333,635 T686A probably benign Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,440,074 probably benign Het
Other mutations in Tenm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Tenm3 APN 8 48417060 missense probably damaging 1.00
IGL00538:Tenm3 APN 8 48236025 missense probably damaging 1.00
IGL00719:Tenm3 APN 8 48279042 missense probably benign 0.39
IGL00720:Tenm3 APN 8 48276421 missense probably damaging 0.98
IGL00870:Tenm3 APN 8 48417132 missense probably benign 0.00
IGL00976:Tenm3 APN 8 48256841 missense probably benign 0.14
IGL01469:Tenm3 APN 8 48236423 missense probably damaging 1.00
IGL01508:Tenm3 APN 8 48276645 missense probably benign 0.09
IGL01590:Tenm3 APN 8 48228802 missense probably damaging 1.00
IGL01610:Tenm3 APN 8 48254477 missense probably damaging 1.00
IGL01874:Tenm3 APN 8 48236758 nonsense probably null
IGL01892:Tenm3 APN 8 48276396 missense probably benign 0.09
IGL02098:Tenm3 APN 8 48276576 missense possibly damaging 0.94
IGL02382:Tenm3 APN 8 48235476 missense probably damaging 1.00
IGL02397:Tenm3 APN 8 48236694 missense possibly damaging 0.94
IGL02475:Tenm3 APN 8 48279198 splice site probably benign
IGL02502:Tenm3 APN 8 48288016 missense probably damaging 1.00
IGL02508:Tenm3 APN 8 48299639 missense probably benign 0.30
IGL02543:Tenm3 APN 8 48298956 missense probably damaging 1.00
IGL02723:Tenm3 APN 8 48276903 missense probably benign 0.02
IGL03037:Tenm3 APN 8 48298878 missense possibly damaging 0.90
IGL03160:Tenm3 APN 8 48646418 missense probably benign 0.05
IGL03268:Tenm3 APN 8 48235523 missense probably damaging 1.00
IGL02988:Tenm3 UTSW 8 48235346 missense probably damaging 0.99
PIT4431001:Tenm3 UTSW 8 48235607 missense probably damaging 1.00
PIT4504001:Tenm3 UTSW 8 48293657 missense probably damaging 1.00
R0079:Tenm3 UTSW 8 48343345 missense possibly damaging 0.90
R0121:Tenm3 UTSW 8 48342659 missense probably damaging 0.99
R0123:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0134:Tenm3 UTSW 8 48674472 missense probably damaging 1.00
R0147:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0148:Tenm3 UTSW 8 48236720 missense probably damaging 1.00
R0309:Tenm3 UTSW 8 48341034 missense probably damaging 1.00
R0322:Tenm3 UTSW 8 48236912 splice site probably benign
R0335:Tenm3 UTSW 8 48232105 missense probably damaging 1.00
R0355:Tenm3 UTSW 8 48228975 missense probably damaging 1.00
R0411:Tenm3 UTSW 8 48287791 missense possibly damaging 0.61
R0505:Tenm3 UTSW 8 48341160 splice site probably benign
R0573:Tenm3 UTSW 8 48674399 splice site probably benign
R0599:Tenm3 UTSW 8 48277710 missense probably damaging 1.00
R0616:Tenm3 UTSW 8 48276156 missense possibly damaging 0.76
R0637:Tenm3 UTSW 8 48236525 missense probably damaging 1.00
R0726:Tenm3 UTSW 8 48236594 missense probably damaging 1.00
R0840:Tenm3 UTSW 8 48335742 missense probably damaging 0.99
R0981:Tenm3 UTSW 8 48298965 missense probably damaging 1.00
R1006:Tenm3 UTSW 8 48228542 missense probably damaging 1.00
R1199:Tenm3 UTSW 8 48235582 missense probably damaging 0.99
R1223:Tenm3 UTSW 8 48240396 missense possibly damaging 0.72
R1240:Tenm3 UTSW 8 48287893 missense possibly damaging 0.74
R1394:Tenm3 UTSW 8 48276400 missense probably benign
R1455:Tenm3 UTSW 8 48279048 missense possibly damaging 0.87
R1459:Tenm3 UTSW 8 48235971 missense probably damaging 1.00
R1473:Tenm3 UTSW 8 48310625 missense probably damaging 1.00
R1501:Tenm3 UTSW 8 48343316 missense probably damaging 0.99
R1507:Tenm3 UTSW 8 48287822 missense probably benign 0.01
R1522:Tenm3 UTSW 8 48395576 missense probably damaging 1.00
R1524:Tenm3 UTSW 8 48228981 missense possibly damaging 0.92
R1553:Tenm3 UTSW 8 48236421 missense probably damaging 1.00
R1572:Tenm3 UTSW 8 48228993 missense possibly damaging 0.94
R1583:Tenm3 UTSW 8 48279074 missense probably benign 0.09
R1676:Tenm3 UTSW 8 48417119 missense possibly damaging 0.83
R1732:Tenm3 UTSW 8 48310634 missense probably damaging 1.00
R1768:Tenm3 UTSW 8 48232104 missense probably damaging 1.00
R1777:Tenm3 UTSW 8 48417179 missense probably benign 0.05
R1793:Tenm3 UTSW 8 48674544 missense probably damaging 0.98
R1801:Tenm3 UTSW 8 48276256 missense probably benign 0.39
R1863:Tenm3 UTSW 8 48276346 missense probably benign 0.20
R1898:Tenm3 UTSW 8 48310761 missense probably damaging 1.00
R1971:Tenm3 UTSW 8 48236313 missense probably damaging 1.00
R1972:Tenm3 UTSW 8 48228591 missense probably damaging 1.00
R1996:Tenm3 UTSW 8 48228668 missense probably damaging 1.00
R2061:Tenm3 UTSW 8 48342256 critical splice donor site probably null
R2109:Tenm3 UTSW 8 48343349 missense possibly damaging 0.94
R2124:Tenm3 UTSW 8 48417006 critical splice donor site probably null
R2190:Tenm3 UTSW 8 48395544 missense probably damaging 1.00
R2204:Tenm3 UTSW 8 48674550 missense probably benign 0.17
R2233:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2234:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2235:Tenm3 UTSW 8 48276169 missense probably benign 0.04
R2237:Tenm3 UTSW 8 48342337 missense probably damaging 1.00
R2418:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2419:Tenm3 UTSW 8 48276658 missense possibly damaging 0.87
R2435:Tenm3 UTSW 8 48287953 missense probably damaging 1.00
R2483:Tenm3 UTSW 8 48240270 missense probably damaging 0.99
R3406:Tenm3 UTSW 8 48228555 missense probably damaging 1.00
R3724:Tenm3 UTSW 8 48277746 missense probably damaging 0.97
R4009:Tenm3 UTSW 8 48349223 missense probably damaging 1.00
R4210:Tenm3 UTSW 8 48349404 missense probably damaging 1.00
R4293:Tenm3 UTSW 8 48395658 missense probably damaging 1.00
R4656:Tenm3 UTSW 8 48293726 missense probably damaging 1.00
R4663:Tenm3 UTSW 8 48235970 missense probably damaging 1.00
R4835:Tenm3 UTSW 8 48313236 critical splice donor site probably null
R4851:Tenm3 UTSW 8 48310621 critical splice donor site probably null
R4867:Tenm3 UTSW 8 48235821 missense probably damaging 1.00
R4892:Tenm3 UTSW 8 48276861 missense probably damaging 0.99
R4895:Tenm3 UTSW 8 48300971 missense probably damaging 1.00
R4962:Tenm3 UTSW 8 48278961 nonsense probably null
R4995:Tenm3 UTSW 8 48229137 missense possibly damaging 0.87
R5091:Tenm3 UTSW 8 48342308 missense probably benign 0.14
R5228:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5253:Tenm3 UTSW 8 48229198 missense possibly damaging 0.92
R5260:Tenm3 UTSW 8 48236855 missense probably damaging 1.00
R5363:Tenm3 UTSW 8 48287831 missense possibly damaging 0.55
R5414:Tenm3 UTSW 8 48236355 missense probably damaging 1.00
R5427:Tenm3 UTSW 8 48236564 missense probably damaging 1.00
R5431:Tenm3 UTSW 8 48367377 nonsense probably null
R5566:Tenm3 UTSW 8 48279006 missense probably damaging 1.00
R5579:Tenm3 UTSW 8 48236764 missense probably damaging 1.00
R5656:Tenm3 UTSW 8 48228762 missense probably damaging 1.00
R5931:Tenm3 UTSW 8 48646498 missense probably benign 0.00
R5959:Tenm3 UTSW 8 48646447 nonsense probably null
R5965:Tenm3 UTSW 8 48228508 nonsense probably null
R6062:Tenm3 UTSW 8 48343406 missense possibly damaging 0.46
R6151:Tenm3 UTSW 8 48395573 missense probably damaging 1.00
R6157:Tenm3 UTSW 8 48298808 missense probably damaging 0.96
R6167:Tenm3 UTSW 8 48254622 missense possibly damaging 0.46
R6217:Tenm3 UTSW 8 48293665 missense probably damaging 0.99
R6233:Tenm3 UTSW 8 48417059 missense probably damaging 1.00
R6270:Tenm3 UTSW 8 48367394 missense probably damaging 0.98
R6329:Tenm3 UTSW 8 48276849 missense probably damaging 0.99
R6466:Tenm3 UTSW 8 48236063 missense probably damaging 0.97
R6515:Tenm3 UTSW 8 48417222 missense probably benign
R6516:Tenm3 UTSW 8 48417222 missense probably benign
R6747:Tenm3 UTSW 8 48343243 missense probably damaging 1.00
R6782:Tenm3 UTSW 8 48646256 critical splice donor site probably null
R6788:Tenm3 UTSW 8 48674493 missense probably damaging 1.00
R6823:Tenm3 UTSW 8 48256837 missense probably damaging 0.99
R6846:Tenm3 UTSW 8 48276738 missense probably benign 0.39
R6913:Tenm3 UTSW 8 48298937 missense probably damaging 0.99
R6941:Tenm3 UTSW 8 48674416 missense probably damaging 0.99
R6950:Tenm3 UTSW 8 48240479 nonsense probably null
R6968:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6970:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R6993:Tenm3 UTSW 8 48236439 missense probably damaging 1.00
R7003:Tenm3 UTSW 8 48240444 missense probably damaging 1.00
R7125:Tenm3 UTSW 8 48674553 missense probably benign 0.00
R7140:Tenm3 UTSW 8 48292236 missense probably damaging 1.00
R7222:Tenm3 UTSW 8 48300969 missense probably damaging 1.00
R7232:Tenm3 UTSW 8 48235935 missense probably damaging 1.00
R7336:Tenm3 UTSW 8 48236177 missense possibly damaging 0.93
R7417:Tenm3 UTSW 8 48236183 missense probably damaging 1.00
R7526:Tenm3 UTSW 8 48287812 missense probably damaging 0.96
R7527:Tenm3 UTSW 8 48276600 missense possibly damaging 0.60
R7616:Tenm3 UTSW 8 48341049 missense possibly damaging 0.56
R7662:Tenm3 UTSW 8 48335727 missense probably benign 0.27
R7734:Tenm3 UTSW 8 48646333 missense probably damaging 1.00
R7802:Tenm3 UTSW 8 48236465 missense probably damaging 1.00
R7812:Tenm3 UTSW 8 48276300 missense probably benign 0.01
R7843:Tenm3 UTSW 8 48229111 nonsense probably null
R7926:Tenm3 UTSW 8 48229111 nonsense probably null
X0010:Tenm3 UTSW 8 48287829 missense probably damaging 0.98
X0025:Tenm3 UTSW 8 48236477 missense probably damaging 1.00
Z1177:Tenm3 UTSW 8 48276780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGAGATGTCCTTGGAGGTC -3'
(R):5'- CATGTGGCGGTACAACTACG -3'

Sequencing Primer
(F):5'- AGAGATGTCCTTGGAGGTCATAGTAC -3'
(R):5'- TGGCGGTACAACTACGACCTAAATG -3'
Posted On2016-05-10