Incidental Mutation 'R0374:Dgka'
ID 38527
Institutional Source Beutler Lab
Gene Symbol Dgka
Ensembl Gene ENSMUSG00000025357
Gene Name diacylglycerol kinase, alpha
Synonyms Dagk1
MMRRC Submission 038580-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock # R0374 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 128720134-128744855 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to C at 128721083 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026414] [ENSMUST00000054125] [ENSMUST00000219834]
AlphaFold O88673
Predicted Effect probably benign
Transcript: ENSMUST00000026414
SMART Domains Protein: ENSMUSP00000026414
Gene: ENSMUSG00000025357

DomainStartEndE-ValueType
Pfam:DAG_kinase_N 4 93 6.9e-31 PFAM
EFh 115 143 3.82e0 SMART
EFh 160 188 1.29e-4 SMART
C1 207 254 2.29e-10 SMART
C1 269 320 6.91e-5 SMART
DAGKc 372 495 3.11e-62 SMART
DAGKa 515 696 4.1e-103 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000054125
SMART Domains Protein: ENSMUSP00000051869
Gene: ENSMUSG00000025359

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
PKD 228 310 3.17e-7 SMART
low complexity region 326 348 N/A INTRINSIC
low complexity region 377 396 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219834
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.9%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the eukaryotic diacylglycerol kinase family. It acts as a modulator that competes with protein kinase C for the second messenger diacylglycerol in intracellular signaling pathways. It also plays an important role in the resynthesis of phosphatidylinositols and phosphorylating diacylglycerol to phosphatidic acid. Alternative splicing occurs at this locus and four transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired induction of T cell anergy. T cells stimulated in anergy producing conditions show increased proliferation and interleukin 2 production. Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5830411N06Rik T A 7: 140,248,961 C178S probably damaging Het
Ano9 A G 7: 141,107,814 I267T probably damaging Het
Anxa6 T A 11: 55,005,828 N168I probably benign Het
Apbb1ip A G 2: 22,819,705 probably benign Het
Aqr G A 2: 114,130,611 H723Y probably damaging Het
Bbx C T 16: 50,280,392 E47K probably benign Het
Car13 A G 3: 14,656,297 probably benign Het
Casp9 T A 4: 141,807,173 I298N possibly damaging Het
Ccdc66 T C 14: 27,498,473 E261G probably damaging Het
Cep192 T A 18: 67,818,883 Y376* probably null Het
Cped1 T A 6: 22,222,546 probably benign Het
Ctbp2 A T 7: 132,999,344 S563R possibly damaging Het
Ctdp1 A G 18: 80,447,422 probably null Het
Drd2 A G 9: 49,399,784 T112A probably benign Het
Dusp1 A G 17: 26,508,169 V52A probably damaging Het
Eea1 T A 10: 96,039,772 probably benign Het
Etfrf1 T C 6: 145,215,562 V86A probably benign Het
Fbn1 A T 2: 125,321,676 C2087S possibly damaging Het
Fosb T G 7: 19,307,150 R139S probably damaging Het
Foxm1 C T 6: 128,372,603 R362W probably damaging Het
Frem2 A G 3: 53,653,960 V1042A probably damaging Het
Gbe1 A G 16: 70,483,914 H401R probably benign Het
Gm10549 C T 18: 33,464,182 probably benign Het
Golga7b A T 19: 42,263,319 probably benign Het
H2-DMb1 T C 17: 34,159,425 V235A probably benign Het
Hr A G 14: 70,556,476 T59A probably benign Het
Itpr2 C A 6: 146,359,392 A588S probably benign Het
Kmt2c G A 5: 25,309,708 P3046S probably damaging Het
Lamc1 G A 1: 153,251,065 probably benign Het
Lrp2 A G 2: 69,430,307 Y4527H probably damaging Het
Map3k2 G A 18: 32,212,173 probably null Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Nfs1 C G 2: 156,132,660 G212R probably damaging Het
Nol8 C T 13: 49,662,447 A677V possibly damaging Het
Nrap T A 19: 56,351,622 Y740F probably damaging Het
Nup205 T A 6: 35,208,837 M859K probably damaging Het
Nxf1 T C 19: 8,767,739 F451S possibly damaging Het
Olfr262 A T 19: 12,241,141 N173K probably damaging Het
Olfr804 G A 10: 129,705,647 M256I probably benign Het
Pcdhac2 T C 18: 37,145,667 Y567H probably damaging Het
Phlpp2 C T 8: 109,907,513 R242W probably damaging Het
Pi4ka A G 16: 17,282,932 probably benign Het
Pmpcb A G 5: 21,748,831 D359G probably damaging Het
Poll T G 19: 45,557,870 S244R probably benign Het
Prkd3 T C 17: 78,957,215 D657G probably null Het
Prune2 G A 19: 17,120,910 M1259I probably benign Het
Ptpra T A 2: 130,537,621 M329K probably damaging Het
Rbm10 GGGAGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG GGGAGGAGGAGGAGGAGGATGAGGAGGAGGAGGAGGAG X: 20,637,559 probably benign Het
Rbm15 G T 3: 107,330,564 D839E probably damaging Het
Sap30bp T A 11: 115,964,277 I271N probably damaging Het
Scn3a A T 2: 65,508,574 V587E probably damaging Het
Setdb1 A T 3: 95,324,853 probably benign Het
Sgk3 T A 1: 9,879,081 probably null Het
Shox2 A T 3: 66,973,851 H265Q probably damaging Het
Slc9a2 T C 1: 40,743,857 F427S possibly damaging Het
Smarca5 T A 8: 80,736,731 Q69H probably benign Het
Specc1l T A 10: 75,248,459 F672Y probably damaging Het
Ssh2 T A 11: 77,408,143 S105R probably damaging Het
Syne2 C T 12: 75,921,226 R917* probably null Het
Tbc1d2 G A 4: 46,649,913 T41M possibly damaging Het
Tbx18 T A 9: 87,724,355 I246F probably damaging Het
Tcf4 T A 18: 69,681,812 probably benign Het
Tmed2 C A 5: 124,541,439 probably null Het
Tmem243 A T 5: 9,101,361 D15V possibly damaging Het
Vmn2r87 T A 10: 130,471,979 S797C probably damaging Het
Vps13c T A 9: 67,886,246 probably benign Het
Wls T A 3: 159,897,437 C162* probably null Het
Zbtb7c C T 18: 76,137,393 T184I probably benign Het
Zc3h13 A G 14: 75,308,965 K169E probably damaging Het
Other mutations in Dgka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Dgka APN 10 128733086 missense probably damaging 1.00
IGL02479:Dgka APN 10 128730246 missense probably benign 0.01
IGL02727:Dgka APN 10 128722448 splice site probably benign
IGL02817:Dgka APN 10 128730228 missense probably benign
IGL02882:Dgka APN 10 128733384 missense possibly damaging 0.77
IGL03239:Dgka APN 10 128721385 splice site probably benign
Caps UTSW 10 128730202 nonsense probably null
Greenie UTSW 10 128733093 missense probably benign 0.03
Hangup UTSW 10 128720487 missense probably damaging 1.00
Stickem UTSW 10 128723679 missense probably damaging 1.00
R0321:Dgka UTSW 10 128721083 splice site probably benign
R0482:Dgka UTSW 10 128734121 nonsense probably null
R0494:Dgka UTSW 10 128721083 splice site probably benign
R0573:Dgka UTSW 10 128737007 critical splice donor site probably null
R0594:Dgka UTSW 10 128733110 splice site probably benign
R0607:Dgka UTSW 10 128720469 splice site probably null
R0618:Dgka UTSW 10 128721083 splice site probably benign
R0691:Dgka UTSW 10 128723260 splice site probably benign
R1378:Dgka UTSW 10 128735827 splice site probably null
R1424:Dgka UTSW 10 128733333 missense possibly damaging 0.57
R1955:Dgka UTSW 10 128730189 critical splice donor site probably null
R1972:Dgka UTSW 10 128720466 missense probably damaging 0.99
R1998:Dgka UTSW 10 128729939 missense probably benign 0.00
R2046:Dgka UTSW 10 128723535 missense probably damaging 1.00
R4206:Dgka UTSW 10 128721195 missense probably damaging 1.00
R4418:Dgka UTSW 10 128728094 missense probably damaging 1.00
R4752:Dgka UTSW 10 128736659 missense probably benign 0.03
R5092:Dgka UTSW 10 128735833 missense probably damaging 0.99
R5479:Dgka UTSW 10 128729672 critical splice acceptor site probably null
R6009:Dgka UTSW 10 128723679 missense probably damaging 1.00
R6273:Dgka UTSW 10 128723646 missense probably benign 0.03
R6852:Dgka UTSW 10 128722539 missense probably damaging 1.00
R6947:Dgka UTSW 10 128733015 missense probably damaging 1.00
R6973:Dgka UTSW 10 128729594 splice site probably null
R7024:Dgka UTSW 10 128720487 missense probably damaging 1.00
R7076:Dgka UTSW 10 128733583 missense probably damaging 0.99
R7290:Dgka UTSW 10 128733599 missense probably damaging 0.99
R7397:Dgka UTSW 10 128720725 missense possibly damaging 0.95
R7823:Dgka UTSW 10 128736266 missense probably benign 0.00
R7856:Dgka UTSW 10 128736664 missense probably benign
R8118:Dgka UTSW 10 128722449 splice site probably null
R8360:Dgka UTSW 10 128728128 missense probably damaging 0.99
R8374:Dgka UTSW 10 128721243 missense probably benign 0.01
R8547:Dgka UTSW 10 128721012 missense probably damaging 1.00
R8686:Dgka UTSW 10 128733093 missense probably benign 0.03
R9013:Dgka UTSW 10 128730202 nonsense probably null
R9307:Dgka UTSW 10 128731177 missense probably damaging 1.00
R9336:Dgka UTSW 10 128731066 critical splice donor site probably null
R9423:Dgka UTSW 10 128721186 missense probably damaging 0.96
X0020:Dgka UTSW 10 128721317 missense probably damaging 1.00
Z1177:Dgka UTSW 10 128720468 missense probably benign 0.00
Z1177:Dgka UTSW 10 128731165 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCCTGCAAGAGGTCGAGAAAGACTG -3'
(R):5'- TATTGAACATCCCGAGCACGCACG -3'

Sequencing Primer
(F):5'- TAGCTTCTATCATGGAGAAAGACCC -3'
(R):5'- GGGTGACACCAAGAGACCTC -3'
Posted On 2013-05-23