Incidental Mutation 'R4996:Fmnl1'
ID 385279
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Name formin-like 1
Synonyms formin-related gene in leukocytes, 8030453N10Rik
MMRRC Submission 042590-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock # R4996 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 103171107-103198901 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103182656 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 167 (S167N)
Ref Sequence ENSEMBL: ENSMUSP00000046296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042286] [ENSMUST00000107027] [ENSMUST00000218163]
AlphaFold Q9JL26
Predicted Effect possibly damaging
Transcript: ENSMUST00000042286
AA Change: S167N

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805
AA Change: S167N

Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107027
AA Change: S167N

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805
AA Change: S167N

Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154871
Predicted Effect possibly damaging
Transcript: ENSMUST00000218163
AA Change: S167N

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,426,349 V173M probably damaging Het
Actl11 A G 9: 107,931,735 I1086V possibly damaging Het
Adgrv1 T C 13: 81,578,734 S500G probably benign Het
Ahcyl1 A T 3: 107,668,287 V394E probably damaging Het
Alg9 T C 9: 50,808,705 F494L probably damaging Het
Ankrd55 C A 13: 112,356,088 D264E possibly damaging Het
Asb14 A G 14: 26,912,116 N426S possibly damaging Het
Atm A T 9: 53,524,507 F168I probably benign Het
Atp13a4 A T 16: 29,472,004 I209N probably damaging Het
BB014433 A T 8: 15,042,166 L229Q probably benign Het
C130026I21Rik G T 1: 85,247,094 A240E probably benign Het
Calml3 T C 13: 3,804,142 D21G probably damaging Het
Capn10 A G 1: 92,945,136 N528S probably damaging Het
Ccnl2 T A 4: 155,813,524 D141E possibly damaging Het
Cd163 A G 6: 124,319,147 I817V probably benign Het
Cgnl1 CTTGCCCAGGTT CTT 9: 71,724,826 probably benign Het
Cln6 T A 9: 62,850,655 I232N probably damaging Het
Col22a1 A C 15: 72,007,161 V49G probably damaging Het
Csmd1 A T 8: 15,910,452 M3321K probably damaging Het
Cyp2u1 T A 3: 131,298,284 M196L probably benign Het
Dlec1 T G 9: 119,146,050 L1566R probably damaging Het
Dnajc3 A G 14: 118,972,427 T305A probably benign Het
Drp2 G A X: 134,441,316 R567H probably damaging Homo
Efhd1 G T 1: 87,264,558 G37W possibly damaging Het
Exph5 G C 9: 53,375,610 E1330D possibly damaging Het
Fam207a A T 10: 77,515,533 W14R probably null Het
Fbln2 A T 6: 91,266,010 Y913F probably benign Het
Frs3 A G 17: 47,701,710 E114G probably damaging Het
Gm960 T A 19: 4,626,084 K673N probably benign Het
Gmpr2 T C 14: 55,676,795 I169T probably damaging Het
Gria2 A G 3: 80,707,141 S531P probably damaging Het
Hace1 G A 10: 45,649,950 A296T probably benign Het
Hrasls G A 16: 29,217,704 W31* probably null Het
Inhbb A C 1: 119,420,818 L90R probably damaging Het
Insr C T 8: 3,192,665 R18Q probably null Het
Kdm6b G T 11: 69,405,731 P570Q probably damaging Het
Lama3 T C 18: 12,518,743 V1803A probably benign Het
Lpin3 T A 2: 160,905,287 L811Q probably damaging Het
Lrrc8e C T 8: 4,235,166 L464F probably damaging Het
Micall2 A G 5: 139,710,589 S729P probably benign Het
Naca C T 10: 128,042,429 probably benign Het
Nav1 A T 1: 135,465,971 S1010T probably damaging Het
Nefm T C 14: 68,121,121 probably benign Het
Nlrp9c A T 7: 26,385,747 F136I possibly damaging Het
Nup210 A T 6: 91,053,436 F137Y probably benign Het
Olfr1079 T C 2: 86,538,271 I215V probably benign Het
Olfr402 A G 11: 74,155,331 H59R probably damaging Het
Olfr98 A G 17: 37,262,867 S266P probably benign Het
Otog C A 7: 46,305,510 C517* probably null Het
Otog C A 7: 46,298,606 H2344N possibly damaging Het
Pcdhac1 C T 18: 37,092,527 Q798* probably null Het
Pdhx T C 2: 103,030,312 D330G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Pgr C A 9: 8,900,913 P149Q probably damaging Het
Ppm1h A T 10: 122,941,340 I504F probably damaging Het
Ppp6r3 A G 19: 3,473,833 S556P probably damaging Het
Ranbp9 G A 13: 43,425,094 Q168* probably null Het
Relb A T 7: 19,615,603 L259Q probably benign Het
Rfx5 G A 3: 94,955,815 V73I probably benign Het
Rgcc T C 14: 79,290,276 D125G possibly damaging Het
Rmnd5b A G 11: 51,627,908 V86A probably damaging Het
Slc15a5 G A 6: 138,043,585 T250M probably damaging Het
Slc7a2 A T 8: 40,912,562 K477* probably null Het
Smc2 T A 4: 52,461,042 probably null Het
Sox5 A T 6: 144,028,344 L226* probably null Het
Syne2 A G 12: 75,943,950 E1903G possibly damaging Het
Tenm3 A T 8: 48,235,826 I2226N probably damaging Het
Tmtc3 A T 10: 100,447,224 I823N probably damaging Het
Tor3a T C 1: 156,655,772 Y360C probably damaging Het
Trpc3 T C 3: 36,662,818 E357G probably benign Het
Ttc30a1 C T 2: 75,979,922 G606S probably benign Het
Tubgcp6 A T 15: 89,103,490 N1093K possibly damaging Het
Vmn1r64 T A 7: 5,884,053 T164S probably benign Het
Vmn2r40 T A 7: 8,908,167 Q709L probably damaging Het
Vmn2r81 A T 10: 79,293,413 I713L probably benign Het
Washc5 T C 15: 59,333,635 T686A probably benign Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103197340 nonsense probably null
IGL00972:Fmnl1 APN 11 103180955 missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103194690 unclassified probably benign
IGL01417:Fmnl1 APN 11 103196694 unclassified probably benign
IGL01599:Fmnl1 APN 11 103186656 missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103192772 missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103179538 missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103196766 unclassified probably benign
IGL03369:Fmnl1 APN 11 103197182 splice site probably null
archetypal UTSW 11 103186627 missense probably damaging 1.00
contractual UTSW 11 103180915 missense probably damaging 1.00
stylistic UTSW 11 103193736 critical splice donor site probably null
R0077:Fmnl1 UTSW 11 103189969 missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103182170 critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103194063 splice site probably benign
R1170:Fmnl1 UTSW 11 103197370 missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103186709 splice site probably null
R1794:Fmnl1 UTSW 11 103197147 missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103192025 missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103194692 missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103194765 unclassified probably benign
R3883:Fmnl1 UTSW 11 103182114 missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103196757 unclassified probably benign
R4658:Fmnl1 UTSW 11 103197694 missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103193736 critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103198564 unclassified probably benign
R5646:Fmnl1 UTSW 11 103196512 unclassified probably benign
R5702:Fmnl1 UTSW 11 103185665 missense probably damaging 1.00
R5850:Fmnl1 UTSW 11 103195285 unclassified probably benign
R5903:Fmnl1 UTSW 11 103171444 splice site probably null
R6254:Fmnl1 UTSW 11 103196315 unclassified probably benign
R6958:Fmnl1 UTSW 11 103171314 start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103194774 unclassified probably benign
R7133:Fmnl1 UTSW 11 103181784 critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103190398 missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103182769 critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103196265 missense unknown
R7448:Fmnl1 UTSW 11 103186627 missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103193128 missense probably damaging 1.00
R7831:Fmnl1 UTSW 11 103198173 missense unknown
R7862:Fmnl1 UTSW 11 103180930 missense probably damaging 1.00
R7973:Fmnl1 UTSW 11 103171158 start gained probably benign
R8177:Fmnl1 UTSW 11 103189959 missense probably damaging 0.98
R8273:Fmnl1 UTSW 11 103186699 missense probably damaging 1.00
R8345:Fmnl1 UTSW 11 103186614 missense possibly damaging 0.88
R8507:Fmnl1 UTSW 11 103194033 missense unknown
R8921:Fmnl1 UTSW 11 103197141 missense unknown
R8946:Fmnl1 UTSW 11 103180915 missense probably damaging 1.00
R8968:Fmnl1 UTSW 11 103186618 small deletion probably benign
R9114:Fmnl1 UTSW 11 103196501 missense unknown
R9696:Fmnl1 UTSW 11 103195471 missense unknown
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2016-05-10