Incidental Mutation 'R4996:Fmnl1'
ID 385279
Institutional Source Beutler Lab
Gene Symbol Fmnl1
Ensembl Gene ENSMUSG00000055805
Gene Name formin-like 1
Synonyms formin-related gene in leukocytes, 8030453N10Rik
MMRRC Submission 042590-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.139) question?
Stock # R4996 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 103061933-103089727 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 103073482 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Asparagine at position 167 (S167N)
Ref Sequence ENSEMBL: ENSMUSP00000046296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042286] [ENSMUST00000107027] [ENSMUST00000218163]
AlphaFold Q9JL26
Predicted Effect possibly damaging
Transcript: ENSMUST00000042286
AA Change: S167N

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000046296
Gene: ENSMUSG00000055805
AA Change: S167N

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
low complexity region 1074 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107027
AA Change: S167N

PolyPhen 2 Score 0.450 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102642
Gene: ENSMUSG00000055805
AA Change: S167N

DomainStartEndE-ValueType
Drf_GBD 27 280 1.04e-87 SMART
Drf_FH3 283 632 2.29e-75 SMART
FH2 627 1057 4.35e-142 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126425
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154871
Predicted Effect possibly damaging
Transcript: ENSMUST00000218163
AA Change: S167N

PolyPhen 2 Score 0.550 (Sensitivity: 0.88; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Constitutive homozygous KO is embryonic lethal. Conditional homozygous KO in myeloid cells leads to reduced macrophage migration and podosome formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930505A04Rik C T 11: 30,376,349 (GRCm39) V173M probably damaging Het
Actl11 A G 9: 107,808,934 (GRCm39) I1086V possibly damaging Het
Adgrv1 T C 13: 81,726,853 (GRCm39) S500G probably benign Het
Ahcyl1 A T 3: 107,575,603 (GRCm39) V394E probably damaging Het
Alg9 T C 9: 50,720,005 (GRCm39) F494L probably damaging Het
Ankrd55 C A 13: 112,492,622 (GRCm39) D264E possibly damaging Het
Asb14 A G 14: 26,634,073 (GRCm39) N426S possibly damaging Het
Atm A T 9: 53,435,807 (GRCm39) F168I probably benign Het
Atp13a4 A T 16: 29,290,822 (GRCm39) I209N probably damaging Het
BB014433 A T 8: 15,092,166 (GRCm39) L229Q probably benign Het
Calml3 T C 13: 3,854,142 (GRCm39) D21G probably damaging Het
Capn10 A G 1: 92,872,858 (GRCm39) N528S probably damaging Het
Ccnl2 T A 4: 155,897,981 (GRCm39) D141E possibly damaging Het
Cd163 A G 6: 124,296,106 (GRCm39) I817V probably benign Het
Cgnl1 CTTGCCCAGGTT CTT 9: 71,632,108 (GRCm39) probably benign Het
Cln6 T A 9: 62,757,937 (GRCm39) I232N probably damaging Het
Col22a1 A C 15: 71,879,010 (GRCm39) V49G probably damaging Het
Csmd1 A T 8: 15,960,452 (GRCm39) M3321K probably damaging Het
Cyp2u1 T A 3: 131,091,933 (GRCm39) M196L probably benign Het
Dlec1 T G 9: 118,975,118 (GRCm39) L1566R probably damaging Het
Dnajc3 A G 14: 119,209,839 (GRCm39) T305A probably benign Het
Drp2 G A X: 133,342,065 (GRCm39) R567H probably damaging Homo
Efhd1 G T 1: 87,192,280 (GRCm39) G37W possibly damaging Het
Exph5 G C 9: 53,286,910 (GRCm39) E1330D possibly damaging Het
Fbln2 A T 6: 91,242,992 (GRCm39) Y913F probably benign Het
Frs3 A G 17: 48,012,635 (GRCm39) E114G probably damaging Het
Gmpr2 T C 14: 55,914,252 (GRCm39) I169T probably damaging Het
Gria2 A G 3: 80,614,448 (GRCm39) S531P probably damaging Het
Hace1 G A 10: 45,526,046 (GRCm39) A296T probably benign Het
Ift70a1 C T 2: 75,810,266 (GRCm39) G606S probably benign Het
Inhbb A C 1: 119,348,548 (GRCm39) L90R probably damaging Het
Insr C T 8: 3,242,665 (GRCm39) R18Q probably null Het
Kdm6b G T 11: 69,296,557 (GRCm39) P570Q probably damaging Het
Lama3 T C 18: 12,651,800 (GRCm39) V1803A probably benign Het
Lpin3 T A 2: 160,747,207 (GRCm39) L811Q probably damaging Het
Lrrc8e C T 8: 4,285,166 (GRCm39) L464F probably damaging Het
Micall2 A G 5: 139,696,344 (GRCm39) S729P probably benign Het
Naca C T 10: 127,878,298 (GRCm39) probably benign Het
Nav1 A T 1: 135,393,709 (GRCm39) S1010T probably damaging Het
Nefm T C 14: 68,358,570 (GRCm39) probably benign Het
Nlrp9c A T 7: 26,085,172 (GRCm39) F136I possibly damaging Het
Nup210 A T 6: 91,030,418 (GRCm39) F137Y probably benign Het
Or1o3 A G 17: 37,573,758 (GRCm39) S266P probably benign Het
Or3a1c A G 11: 74,046,157 (GRCm39) H59R probably damaging Het
Or8k32 T C 2: 86,368,615 (GRCm39) I215V probably benign Het
Otog C A 7: 45,948,030 (GRCm39) H2344N possibly damaging Het
Otog C A 7: 45,954,934 (GRCm39) C517* probably null Het
Pcdhac1 C T 18: 37,225,580 (GRCm39) Q798* probably null Het
Pdhx T C 2: 102,860,657 (GRCm39) D330G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 (GRCm39) probably benign Het
Pgr C A 9: 8,900,914 (GRCm39) P149Q probably damaging Het
Plaat1 G A 16: 29,036,456 (GRCm39) W31* probably null Het
Ppm1h A T 10: 122,777,245 (GRCm39) I504F probably damaging Het
Ppp6r3 A G 19: 3,523,833 (GRCm39) S556P probably damaging Het
Ranbp9 G A 13: 43,578,570 (GRCm39) Q168* probably null Het
Relb A T 7: 19,349,528 (GRCm39) L259Q probably benign Het
Rfx5 G A 3: 94,863,126 (GRCm39) V73I probably benign Het
Rgcc T C 14: 79,527,716 (GRCm39) D125G possibly damaging Het
Rmnd5b A G 11: 51,518,735 (GRCm39) V86A probably damaging Het
Slc15a5 G A 6: 138,020,583 (GRCm39) T250M probably damaging Het
Slc7a2 A T 8: 41,365,599 (GRCm39) K477* probably null Het
Slx9 A T 10: 77,351,367 (GRCm39) W14R probably null Het
Smc2 T A 4: 52,461,042 (GRCm39) probably null Het
Sox5 A T 6: 143,974,070 (GRCm39) L226* probably null Het
Sp140l2 G T 1: 85,224,815 (GRCm39) A240E probably benign Het
Syne2 A G 12: 75,990,724 (GRCm39) E1903G possibly damaging Het
Tenm3 A T 8: 48,688,861 (GRCm39) I2226N probably damaging Het
Tmtc3 A T 10: 100,283,086 (GRCm39) I823N probably damaging Het
Top6bl T A 19: 4,676,112 (GRCm39) K673N probably benign Het
Tor3a T C 1: 156,483,342 (GRCm39) Y360C probably damaging Het
Trpc3 T C 3: 36,716,967 (GRCm39) E357G probably benign Het
Tubgcp6 A T 15: 88,987,693 (GRCm39) N1093K possibly damaging Het
Vmn1r64 T A 7: 5,887,052 (GRCm39) T164S probably benign Het
Vmn2r40 T A 7: 8,911,166 (GRCm39) Q709L probably damaging Het
Vmn2r81 A T 10: 79,129,247 (GRCm39) I713L probably benign Het
Washc5 T C 15: 59,205,484 (GRCm39) T686A probably benign Het
Wipf1 GCCTCCTCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCCTCCTCC 2: 73,270,418 (GRCm39) probably benign Het
Other mutations in Fmnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Fmnl1 APN 11 103,088,166 (GRCm39) nonsense probably null
IGL00972:Fmnl1 APN 11 103,071,781 (GRCm39) missense probably damaging 1.00
IGL01406:Fmnl1 APN 11 103,085,516 (GRCm39) unclassified probably benign
IGL01417:Fmnl1 APN 11 103,087,520 (GRCm39) unclassified probably benign
IGL01599:Fmnl1 APN 11 103,077,482 (GRCm39) missense probably damaging 1.00
IGL02151:Fmnl1 APN 11 103,083,598 (GRCm39) missense probably benign 0.38
IGL02324:Fmnl1 APN 11 103,070,364 (GRCm39) missense probably damaging 1.00
IGL02812:Fmnl1 APN 11 103,087,592 (GRCm39) unclassified probably benign
IGL03369:Fmnl1 APN 11 103,088,008 (GRCm39) splice site probably null
archetypal UTSW 11 103,077,453 (GRCm39) missense probably damaging 1.00
contractual UTSW 11 103,071,741 (GRCm39) missense probably damaging 1.00
stylistic UTSW 11 103,084,562 (GRCm39) critical splice donor site probably null
R0077:Fmnl1 UTSW 11 103,080,795 (GRCm39) missense probably damaging 1.00
R0241:Fmnl1 UTSW 11 103,072,996 (GRCm39) critical splice donor site probably null
R0241:Fmnl1 UTSW 11 103,072,996 (GRCm39) critical splice donor site probably null
R0413:Fmnl1 UTSW 11 103,084,889 (GRCm39) splice site probably benign
R1170:Fmnl1 UTSW 11 103,088,196 (GRCm39) missense probably benign 0.02
R1389:Fmnl1 UTSW 11 103,077,535 (GRCm39) splice site probably null
R1794:Fmnl1 UTSW 11 103,087,973 (GRCm39) missense probably benign 0.00
R2082:Fmnl1 UTSW 11 103,082,851 (GRCm39) missense probably damaging 1.00
R2105:Fmnl1 UTSW 11 103,085,518 (GRCm39) missense probably benign 0.39
R3611:Fmnl1 UTSW 11 103,085,591 (GRCm39) unclassified probably benign
R3883:Fmnl1 UTSW 11 103,072,940 (GRCm39) missense probably damaging 1.00
R3893:Fmnl1 UTSW 11 103,087,583 (GRCm39) unclassified probably benign
R4658:Fmnl1 UTSW 11 103,088,520 (GRCm39) missense probably damaging 1.00
R4689:Fmnl1 UTSW 11 103,084,562 (GRCm39) critical splice donor site probably null
R4812:Fmnl1 UTSW 11 103,089,390 (GRCm39) unclassified probably benign
R5646:Fmnl1 UTSW 11 103,087,338 (GRCm39) unclassified probably benign
R5702:Fmnl1 UTSW 11 103,076,491 (GRCm39) missense probably damaging 1.00
R5850:Fmnl1 UTSW 11 103,086,111 (GRCm39) unclassified probably benign
R5903:Fmnl1 UTSW 11 103,062,270 (GRCm39) splice site probably null
R6254:Fmnl1 UTSW 11 103,087,141 (GRCm39) unclassified probably benign
R6958:Fmnl1 UTSW 11 103,062,140 (GRCm39) start codon destroyed probably null 1.00
R7030:Fmnl1 UTSW 11 103,085,600 (GRCm39) unclassified probably benign
R7133:Fmnl1 UTSW 11 103,072,610 (GRCm39) critical splice donor site probably null
R7171:Fmnl1 UTSW 11 103,081,224 (GRCm39) missense probably damaging 1.00
R7224:Fmnl1 UTSW 11 103,073,595 (GRCm39) critical splice donor site probably null
R7282:Fmnl1 UTSW 11 103,087,091 (GRCm39) missense unknown
R7448:Fmnl1 UTSW 11 103,077,453 (GRCm39) missense probably damaging 1.00
R7463:Fmnl1 UTSW 11 103,083,954 (GRCm39) missense probably damaging 1.00
R7831:Fmnl1 UTSW 11 103,088,999 (GRCm39) missense unknown
R7862:Fmnl1 UTSW 11 103,071,756 (GRCm39) missense probably damaging 1.00
R7973:Fmnl1 UTSW 11 103,061,984 (GRCm39) start gained probably benign
R8177:Fmnl1 UTSW 11 103,080,785 (GRCm39) missense probably damaging 0.98
R8273:Fmnl1 UTSW 11 103,077,525 (GRCm39) missense probably damaging 1.00
R8345:Fmnl1 UTSW 11 103,077,440 (GRCm39) missense possibly damaging 0.88
R8507:Fmnl1 UTSW 11 103,084,859 (GRCm39) missense unknown
R8921:Fmnl1 UTSW 11 103,087,967 (GRCm39) missense unknown
R8946:Fmnl1 UTSW 11 103,071,741 (GRCm39) missense probably damaging 1.00
R8968:Fmnl1 UTSW 11 103,077,444 (GRCm39) small deletion probably benign
R9114:Fmnl1 UTSW 11 103,087,327 (GRCm39) missense unknown
R9696:Fmnl1 UTSW 11 103,086,297 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CCTCACTGTGCTCACCATAG -3'
(R):5'- TGTTTACATGTGGCAACGGG -3'

Sequencing Primer
(F):5'- GCCTGATCTACATAATGAGAGCCTG -3'
(R):5'- CAACGGGGGTCTCTGTTCTC -3'
Posted On 2016-05-10